»ö« | perl6.org/ | evalbot usage: 'perl6: say 3;' or rakudo:, alpha:, pugs:, std:, or /msg p6eval perl6: ... | irclog: irc.pugscode.org/ | UTF-8 is our friend!
Set by moritz_ on 25 June 2010.
TimToady not yet 00:00
00:01 Psyche^ joined
sorear svn has some stupid feature where, after a checkin, . is out of date 00:01
s_mosher ok, thanks for the help 00:02
00:04 Patterner left, Psyche^ is now known as Patterner
lue wishes he could use Perl6 instead of Javascript to code webpages. 00:06
Juerd I don't do complex stuff in webpages, and javascript+jquery suffices for me :) 00:12
sjohnson lue: you are not a lone. don't tell diakopter that though 00:14
:)
alone*
rakudoscript
would be a great day for mankind's achievement
00:15 lestrrat is now known as lest_away
lue I use javascript for, say, making navigation updating easy. And it's been a while. Perl 6 has scarred my feelings for Javascript. 00:18
.oO(I just want to type <script type="text/perl6"> and be done with it. Instead, I have to relearn something I'll never bother with beyond the internet.)
 00:21
diakopter wait, there's something beyond the internet?
lue .oO[ then again, that would mean browsers would be forced to interpret Perl 6. Which isn't a bad thing, of course :) ] 00:23
Although there are Perl 6 coded things for the web (like November), so there is hope... 00:26
rakudo: say "tardis".pick(*) 00:31
p6eval rakudo 56c846: OUTPUT«tardis␤»
lue oh, let me guess, it doesn't treat that as an array of characters? 00:32
pugssvn r32056 | sorear++ | [STD-dist] Follow all changes to STD, automatically extract version from svn, and add my email. 00:33
sjohnson best example of javascript difficulty is doing heredoc's in it
it's like pulling teeth
lue rakudo: say "tardis".split('').pick(*) 00:34
p6eval rakudo 56c846: OUTPUT«rdsiat␤»
lue rakudo: say ("tardis".split('').pick(*) xx 3)
p6eval rakudo 56c846: OUTPUT«atirsdatirsdatirsd␤» 00:35
lue rakudo: say "tardis".split('').pick(*)
00:35 tbourdon_ left
p6eval rakudo 56c846: OUTPUT«itasdr␤» 00:35
tylercurtis rakudo: say "tardis".comb.pick(*) 00:36
p6eval rakudo 56c846: OUTPUT«rsatdi␤»
00:36 tylercurtis left
sorear std: 2+2 00:38
p6eval std 32055: OUTPUT«ok 00:01 116m␤»
sorear STD 32056 has been sent to CPAN 00:40
(but with the wrong version number, svn--)
00:44 mulander joined, rgrau joined 00:54 jaldhar joined
sorear STD is now indexed on CPAN 01:00
01:14 dju joined 01:17 dju left 01:19 drbean joined 01:20 dju joined 01:22 dju left 01:29 dju joined 01:30 isBEKaml_ left, am0c_ joined, am0c_ is now known as am0c 01:32 am0c left 01:34 dju left, dju joined 01:38 dju left, dju joined 01:39 jaldhar left 01:47 justatheory joined 01:48 hewei joined 01:53 justatheory left 01:54 hewei left 01:56 s_mosher left 01:59 Clem_Chong joined 02:04 whiteknight left 02:06 redicaps joined 02:10 getpwnam joined 02:11 araujo joined 02:15 lest_away is now known as lestrrat 02:16 getpwnam left 02:29 rgrau_ joined, rgrau left 02:31 azert0x left 02:46 rgrau__ joined, rgrau__ left, rgrau_ left 02:49 tylercurtis joined 02:52 constant joined, constant left, constant joined 03:01 jaldhar joined 03:07 melte joined
dalek ecza: d8781ea | sorear++ | STD_REVISION:
32053 -> 32055 for Windows fixes
 03:14
ecza: 9a33e36 | sorear++ | / (3 files):
Integrate Niecza and STD level module metadata
ecza: 2e8433a | sorear++ | / (6 files):
Store generated code in build/
ecza: f71920f | sorear++ | / (31 files):
build -> obj, move perl5 compiler parts to src/
03:31 redicaps left 03:38 Clem_Chong left 03:44 redicaps joined
ingy hi 03:56
how do you tell a grammar rule not to backtrack before this point?
ie, this token is a match, if something past it fails, stop and fail. 03:57
tylercurtis ::, I think.
perlcabal.org/syn/S05.html#Backtracking_control
ingy tylercurtis: yeah I'm reading that already, but not taking much away. 03:59
rcfox It is kind of hard to read. 04:00
ingy so this: [ if :: not | ify ]
'if' is just a pattern?
tylercurtis Right. 04:01
Although that's probably a bad example, since ify would beat if on LTM, I think.
ingy could be: [ xx :: yy | zz ]
what is ify?
tylercurtis The same as "ify"
ingy i mean, is ify a perl 6 command? 04:02
not in the grammar but in real life
tylercurtis Not that I'm aware of. 04:03
ingy anyway :: works for me as a syntax. I'm not sure I fully grok the semantics. nor how it compares to the ::: or the : 04:04
anyway, it's a start 04:05
I'll read the tests when I have morning brain power...
I'm about halfway through being able to compile a pegex grammar with pegex itself 04:06
I wrote a bootstrapping parser/compiler
04:06 wooden joined, wooden left, wooden joined
sorear ingy: if you want the entire match to fail, use <commit> 04:06
ingy so now I am building a suite of tests that make sure the two match
04:07 achromic left
ingy sorear: <commit> is a special rule name? 04:07
sorear ingy: yes, it's predefined. no, you can override it, it's just a method like anything else. 04:08
tylercurtis ingy: well, if you had regex a { [ [ if :: foo | something ] | something else ] }, it could still backtrack into the something else part. But if you had ::: instead, the whole rule would fail. I think.
ingy pegex would use <COMMIT> as uppercase is the namespacing between user defined and language defined....
sorear <commit> in perl6 is no more magical than &die 04:09
it hooks into runtime functions, but it's itself quite ordinary
ingy yeah, I get it. I just don't like the namespacing the perl 6 uses. requires to much special knowledge
04:10 [Coke] joined
ingy and doesn't seem future proof thoughtful... 04:10
[Coke] . 04:11
ingy although that seems to be the perl6 attitude.
it's done when we say it is.
unless we decide it's not.
:)
04:12 achromic joined
ingy tylercurtis: i'll copy your example to a local file and look in the morning. 04:12
to tired and cranky
can't you tell? ;)
too
tylercurtis I don't think there's really much risk of clashes. If code has a <foo> subrule call in a grammar, that means that there must be a a foo defined somewhere in its MRO. So, if a <foo> predefined subrule gets added, it just gets added in Grammar(or is it Cursor?). The defined one in the grammar still takes precedence. The only problem is that it can be confusing to read. 04:15
04:21 go|dfish joined
ingy tylercurtis: nod. TestML uses the UPPER vs lower namespacing, and it plays out well, so I'm trying adopting it for pegex 04:21
i think it makes easier grokking, 04:22
sorear Namespacing is great for a fairly static language 04:35
Old-school Perl used foo() for system functions and &foo() for user ones
04:35 macroron joined
sorear But once you start building up a culture of extension, the distinction between system functions and library functions becomes less important, and so people like to call them the same 04:36
ingy sorear: that's a good point... 04:41
dukeleto How does one put something into boolean context in Perl 6?
[Coke] dukeleto: ?what
ingy star: say Bool(42)
p6eval star 2010.07: OUTPUT«Could not find sub &Bool␤ in main program body at line 22:/tmp/JPREEoQwVF␤»
[Coke] star: say ?42
tylercurtis star: say 42.Bool
p6eval star 2010.07: OUTPUT«1␤» 04:42
dukeleto thanks!
ingy dukeleto: tmtowtdiaalowtdiw
(and at least one way to do it wrong) 04:43
rcfox Does .ast work for Matches?
I keep getting Any()
tylercurtis rcfox: are you sure you're using &make?
rcfox What?
rakudo: my $a = 'test' ~~ /(t(.*)t)/; say $a.ast; 04:44
p6eval rakudo 56c846: OUTPUT«Any()␤»
tylercurtis That's correct.
rcfox What is &make?
ingy it puts things in the ast 04:45
that's all I know...
rcfox Oh.
tylercurtis rakudo: grammar Foo { token TOP { abc } }; class Foo::Actions { method TOP($/) { make ~$/; } }; say Foo.parse(:actions(Foo::Actions.new), 'abc')).ast 04:46
p6eval rakudo 56c846: OUTPUT«===SORRY!===␤Confused at line 22, near ").ast"␤»
tylercurtis rakudo: grammar Foo { token TOP { abc } }; class Foo::Actions { method TOP($/) { make ~$/; } }; say Foo.parse(:actions(Foo::Actions.new), 'abc').ast
p6eval rakudo 56c846: OUTPUT«abc␤»
tylercurtis rakudo: grammar Foo { token TOP { abc } }; class Foo::Actions { method TOP($/) { make 5; } }; say Foo.parse(:actions(Foo::Actions.new), 'abc').ast
p6eval rakudo 56c846: OUTPUT«5␤»
rcfox Where is this documented? 04:47
tylercurtis perlcabal.org/syn/S05.html#Match_objects
rcfox And the actions thing? 04:49
I saw something about it in the grammar section, but it's just like "Oh, and here you pass a reference to actions." 04:50
No information about what they are or how to use them...
tylercurtis hmm... I don't see anything in the spec describing it.
dukeleto sorear: i added a test to PL/Parrot that shows off Perl 6 grammars : github.com/leto/plparrot/commit/804...1581c18d7d 04:51
tylercurtis: is it described in the Squaak tutorial ?
tylercurtis dukeleto: Well, it's definitely demonstrated in it, but I don't remember if it explains in detail how they work.
rcfox: perl6advent.wordpress.com/2009/12/2...d-actions/ 04:52
dukeleto tylercurtis: that might be something nice to add
04:53 melte left
rcfox Hm, thanks. 04:54
04:54 melte joined
pugssvn r32057 | pmichaud++ | [t/spec]: Update some Nil-related tests for undefined Nil. 05:10
r32058 | pmichaud++ | [t/spec]: Fudge some Nil-related tests. 05:12
05:22 mutewit joined 05:32 Clem_Chong joined, blogometer left
Clem_Chong evalbot usage:'perl6:say hello;' 05:33
perl6:say hello; 05:34
tylercurtis You want perl6: say 'foo', although I'd recommend just doing star: say 'foo' or rakudo: say 'foo'. perl6: is a bit noisy. 05:35
05:37 macroron left
Clem_Chong perl6:say 'foo'; 05:37
tylercurtis You need a space there after the colon, I think.
Clem_Chong perl6: say 'foo'; 05:38
p6eval pugs, rakudo 56c846: OUTPUT«foo␤»
Clem_Chong :(
rcfox Clem_Chong: Darn, it works.
tylercurtis Well, it seems perl6: has been trimmed down a little.
rcfox How can I add another argument to the .ast method signatures? 05:39
Clem_Chong Ok,don't play that,I find you perl guy's code is smart,how can you do that? 05:40
rcfox method foo($/, $bar) gives me this when I try to call $/<foo>.ast(3): 'Not enough positional parameters passed; got 2 but expected 3'
I'd like to be able to pass along the node depth. 05:42
mathw o/ 05:44
dukeleto has anybody done any kind of SHA implementation in Perl 6? 05:46
sorear rcfox: ast is just a variable, it doesn't call methods at all 05:47
05:47 [Coke] left
sorear Clem_Chong: I'm terrible with pronouns. How can I do what? 05:49
05:55 wtw joined 05:59 kaare joined, kaare is now known as Guest2438
dalek kudo: 7530af5 | mathw++ | docs/ChangeLog:
Update ChangeLog for 2010.08 release.
 06:00
kudo: f1b8aca | mathw++ | docs/announce/2010.08:
Finish release announcement for 2010.08.
kudo: 99a4e24 | mathw++ | docs/release_guide.pod:
Update release guide with 2010.08 release.
06:03 drbean left 06:12 uniejo joined
dalek ecza: b82b1c8 | sorear++ | / (16 files):
Move Perl6 runtime library code to lib/
 06:25
ecza: 14af68a | sorear++ | / (2 files):
Allow niecza to be used from outside the source tree

It's not installable, but you can symlink it into $PATH and it will be able to find the standard libraries and support code.
06:30 wooden left 06:31 wooden joined, wooden left 06:34 drbean joined 06:36 wooden joined, wooden left, wooden joined 06:50 Guest2438 is now known as kaare_ 06:52 tylercurtis left 06:54 mberends left 07:04 tylercurtis joined
sorear I wonder if I should commit a copy of the compiled Niecza grammar 07:05
07:16 tylercurtis left 07:17 wtw left, wtw joined 07:21 timbunce joined 07:43 _madmax_ left 08:00 mulander left 08:02 flatwhatson left, sftp left, cotto_work left, drbean left, mmmpork left, timbunce left, uniejo left, kaare_ left, simcop2387 left, krunen_ left, go|dfish left, [particle] left, pugssvn left, PerlJam left, wooden left, constant left, Grrrr left, NOTevil left, hsb left, melte left, ruoso left, hercynium left, daemon left, PZt left, shade_ left 08:19 xinming_ left 08:20 xinming joined 08:24 thebird joined 08:35 dakkar joined 08:38 _madmax_ joined 08:41 [synth] joined 08:42 synth left 08:46 betterworld joined 08:48 snearch joined, melte joined, ruoso joined, hercynium joined, daemon joined, PZt joined, jdv79 joined, TiMBuS joined, astinus joined, treed joined, timdemkowsky joined, patch joined, breinbaas joined, frooh joined 08:51 mulander joined 08:56 f00li5h joined 08:57 sunnavy_ joined, krakan_ joined, f00li5h left, f00li5h joined 08:58 pjcj_ joined, hillu_ joined 09:03 HarryS left, japhb left, BinGOs left, shelling_lab left, mulander left, snearch left, melte left, ruoso left, hercynium left, daemon left, PZt left, jdv79 left, TiMBuS left, astinus left, timdemkowsky left, breinbaas left, frooh left, patch left, treed left, betterworld left, wtw left, dju left, pnu left, Util left, cozmic left, ascent_ left, spacebat left, kirillm left, jjore left, shabble left, Getty left, Gothmog_ left, cono left, dalek left, _sri left, Bucciarati left, mathw left, lestrrat left, frodwith left, m6locks left 09:12 Trashlord joined, betterworld joined, wtw joined, dju joined, cozmic joined, pnu joined, Util joined, avuserow joined, mantovani joined, itz joined, barika joined, stepnem joined, jettero joined, jnthn joined, nperez joined, spq1 joined, tomaw joined, ascent_ joined, kirillm joined, spacebat joined, shabble joined, Getty joined, jjore joined, Gothmog_ joined 09:13 cono joined, proller_ joined, cottoo joined, nadim joined, thepler joined, _sri joined, Bucciarati joined, mathw joined, lestrrat joined, m6locks joined, frodwith joined 09:14 slavik joined, snearch joined, melte joined, ruoso joined, hercynium joined, daemon joined, PZt joined, jdv79 joined, TiMBuS joined, astinus joined, treed joined, timdemkowsky joined, patch joined, breinbaas joined, frooh joined, Trashlord is now known as Guest41392, HarryS joined, mulander joined, Guest41392 left, betterworld left, wtw left, dju left, pnu left, Util left, avuserow left, mantovani left, cozmic left, itz left, barika left, stepnem left, jettero left, jnthn left, nperez left, spq1 left, tomaw left, ascent_ left, spacebat left, kirillm left, jjore left, shabble left, Getty left, Gothmog_ left, HarryS left, mulander left, slavik left, snearch left, melte left, ruoso left, hercynium left, daemon left, PZt left, jdv79 left, TiMBuS left, astinus left, timdemkowsky left, breinbaas left, frooh left, patch left, treed left 09:15 cono left, proller_ left, cottoo left, nadim left, thepler left, _sri left, Bucciarati left, mathw left, lestrrat left, frodwith left, m6locks left 09:17 japhb joined, mulander joined, frooh joined, breinbaas joined, patch joined, timdemkowsky joined, treed joined, astinus joined, TiMBuS joined, jdv79 joined, PZt joined, daemon joined, hercynium joined, ruoso joined, melte joined, snearch joined, slavik joined, frodwith joined, m6locks joined, lestrrat joined, mathw joined, Bucciarati joined, _sri joined, thepler joined, nadim joined, cottoo joined, proller_ joined, cono joined, Guest41392 joined, betterworld joined, wtw joined, dju joined, cozmic joined, pnu joined, Util joined, avuserow joined, mantovani joined, itz joined, barika joined, stepnem joined, jettero joined, jnthn joined, nperez joined, spq1 joined, tomaw joined, ascent_ joined, kirillm joined, spacebat joined, shabble joined, Getty joined, jjore joined, Gothmog_ joined 09:18 eternale1e joined, nine_ joined, Helios- joined, uniejo joined, kaare_ joined 09:19 [particle] joined, pugssvn joined, PerlJam joined, osfameron joined, takadonet joined, bbkr joined, pochi joined, cosimo joined, gabiruh joined, perigrin joined, _ilbot2 joined, Sanitoeter joined, PacoLinux joined, xiaolongxia joined, yahooooo joined, card.freenode.net sets mode: +vv pugssvn _ilbot2 09:20 HarryS joined, go|dfish joined, simcop2387 joined, krunen_ joined, au|irc joined, lucs joined, kst joined, rbuels joined, Sarten-X2 joined, draxil joined, Woody2143 joined, dalek joined, jedai_ joined, flatwhatson joined, sftp joined, gfldex joined, moritz_ joined, thebird is now known as 84XAATGC2 09:21 thebird joined, Lorn joined, daxim joined, foodoo joined, wooden joined, constant joined, Grrrr joined, NOTevil joined, hsb joined, literal joined, avar joined, IllvilJa joined, kolibrie_ joined, cognominal joined, felliott__ joined, robinsmidsrod joined, Snowclone joined, Maddingue joined, shelling_lab joined, drbean joined, mmmpork joined, huf joined, x3nU joined, phenny joined, renormalist joined, aesop joined, rokoteko joined, card.freenode.net sets mode: +v phenny, cotto_work joined, WAA3OEL joined, Guest41392 left, betterworld left, wtw left, dju left, pnu left, Util left, avuserow left, mantovani left, cozmic left, itz left, barika left, stepnem left, jettero left, jnthn left, nperez left, spq1 left, tomaw left, ascent_ left, spacebat left, kirillm left, jjore left, shabble left, Getty left, Gothmog_ left, shelling_lab left, drbean left, mmmpork left, huf left, x3nU left, phenny left, renormalist left, aesop left, rokoteko left, thebird left, Lorn left, daxim left, foodoo left, wooden left, constant left, Grrrr left, NOTevil left, hsb left, literal left, avar left, IllvilJa left, kolibrie_ left, cognominal left, felliott__ left, Snowclone left, robinsmidsrod left, Maddingue left, cotto_work left, dalek left 09:22 jedai_ left, flatwhatson left, sftp left, gfldex left, moritz_ left, simcop2387 left, krunen_ left, go|dfish left, au|irc left, lucs left, kst left, rbuels left, Sarten-X2 left, Woody2143 left, draxil left, [particle] left, pugssvn left, PerlJam left, takadonet left, bbkr left, pochi left, cosimo left, gabiruh left, perigrin left, _ilbot2 left, osfameron left, Sanitoeter left, PacoLinux left, xiaolongxia left, yahooooo left, uniejo left, kaare_ left, HarryS left, mulander left, japhb left, slavik left, snearch left, melte left, ruoso left, hercynium left, daemon left, PZt left, jdv79 left, TiMBuS left, astinus left, timdemkowsky left, breinbaas left, frooh left, patch left, treed left, cono left, proller_ left, cottoo left, nadim left, thepler left, _sri left, Bucciarati left, mathw left, lestrrat left, frodwith left, m6locks left 09:23 cls_bsd_ joined 09:26 Tene left 09:29 84XAATGC2 left, cls_bsd_ is now known as cls_bsd, szabgab left, grew left 09:31 araujo left 09:35 wamba joined, meteorjay joined, szabgab joined, buubot joined, BinGOs joined, c9s joined, grew_ joined, rhr_ joined, TimToady_ joined, WAA3OEL joined, cotto_work joined, rokoteko joined, aesop joined, renormalist joined, phenny joined, x3nU joined, huf joined, mmmpork joined, shelling_lab joined, Maddingue joined, Snowclone joined, robinsmidsrod joined, felliott__ joined, cognominal joined, kolibrie_ joined, IllvilJa joined, avar joined, literal joined, hsb joined, NOTevil joined, Grrrr joined, constant joined, wooden joined, foodoo joined, daxim joined, Lorn joined, thebird joined, moritz_ joined, gfldex joined, sftp joined, flatwhatson joined, jedai_ joined, dalek joined, Woody2143 joined, draxil joined, Sarten-X2 joined, rbuels joined, card.freenode.net sets mode: +v phenny, kst joined, lucs joined, au|irc joined, krunen_ joined, simcop2387 joined, go|dfish joined, HarryS joined, yahooooo joined, xiaolongxia joined, PacoLinux joined, Sanitoeter joined, _ilbot2 joined, perigrin joined, gabiruh joined, cosimo joined, pochi joined, bbkr joined, takadonet joined, osfameron joined, PerlJam joined, pugssvn joined, [particle] joined, kaare_ joined, uniejo joined, japhb joined, mulander joined, frooh joined, breinbaas joined, patch joined, timdemkowsky joined, treed joined, astinus joined, TiMBuS joined, jdv79 joined, PZt joined, daemon joined, hercynium joined, ruoso joined, melte joined, snearch joined, slavik joined, frodwith joined, m6locks joined, lestrrat joined, mathw joined, Bucciarati joined, _sri joined, card.freenode.net sets mode: +vv _ilbot2 pugssvn, thepler joined, nadim joined, cottoo joined, proller_ joined, cono joined, Guest41392 joined, betterworld joined, wtw joined, dju joined, cozmic joined, pnu joined, Util joined, avuserow joined, mantovani joined, itz joined, barika joined, stepnem joined, jettero joined, jnthn joined, nperez joined, spq1 joined, tomaw joined, ascent_ joined, kirillm joined, spacebat joined, shabble joined, Getty joined, jjore joined, Gothmog_ joined 09:36 araujo joined, ChanServ sets mode: +v dalek, HarryS is now known as Guest197 09:37 masak joined, BinGOs left, BinGOs joined
masak oh hai, #perl6! 09:37
sorear Hi masak!
moritz_ oh hai masak
frettled Don't jump the shark, masak!
moritz_ seems we have bad net weather
Juerd Where's the forecast?
masak frettled: I've never grokked that expression. 09:38
moritz_ Juerd: netsplits and tcplightning
frettled masak: en.wikipedia.org/wiki/Jumping_the_shark
masak thank you. 09:39
frettled masak: I understand it intellectually, but as I haven't seen the show they refer to, it remains a distant connection for me, too.
masak wow. a TV show where they actually jumped an actual shark. 09:40
frettled :)
daxim blow your mind: tvtropes.org/pmwiki/pmwiki.php/Main...ngTheShark (careful, wiki crack)
09:45 Guest197 left, HarryS joined 09:47 pnate joined 09:52 redicaps left 09:54 redicaps joined, redicaps left
jnthn oh morning 09:54
sorear hello jnthn
moritz_ \o
dalek ecza: affeabf | sorear++ | src/ (3 files):
Embed transitive dependency info in metadata
 09:55
ecza: 94a7784 | sorear++ | / (7 files):
Disallow compiling modules by file name

The important case always starts with a module name, and it's much simpler if we always start with one.
ecza: 7a02246 | sorear++ | src/CompilerDriver.pm:
Implement automatic compilation of imported modules
masak sorear++ # STD on CPAN
moritz_ jnthn: would you like to have 6model commits reported here?
masak sorear: how come viv isn't marked executable?
09:56 M_o_C joined
jnthn moritz_: I don't mind either way - as the note on the repo says, it's meant to be temporary. 09:57
sorear masak: 1, I don't understand that aspect of the toolchain
2, I didn't see an easy way to make it marked
jnthn moritz_: If people are interested in seeing what's going on there, then I've no objections.
sorear 3, It wouldn't work anyway 09:58
viv needs a large amount of rethinking before it's usable as a tool in $PATH
masak sorear: fair enough. just wondering. in the best of worlds, it might even be installed as a 'binary' somewhere.
oh, ok.
sorear for some reason pmurias insists on using require 'viv'; to load the STD module 09:59
I keep trying to tell him that "use STD" will work just as well
masak aye
sorear masak: In case you missed it, STD's been on CPAN for a while; I just pushed a new version 10:00
masak I was dimly aware it's been there for a while. but I don't think I've ++'d you for it :) 10:04
sorear You shouldn't have. It's all pmurias++ fault 10:05
masak pmurias++
sorear also GSoC++
hmm, not having any way to access terminal input puts a real crimp on what little demos I can do 10:08
10:08 dalek left, dalek joined 10:09 ChanServ sets mode: +v dalek
masak sorear: the install of STD seemed to have gone fine, but when I use it I get this: gist.github.com/537522 10:09
sorear masak: the installable version of STD only comes with one setting, NULL 10:10
(this is one of the issues I need to understand to make a usable installed viv)
10:11 Clem_Chong_ joined
masak I don't see what 'only comes with one setting, NULL' would mean in this case, or how it relates to my error. 10:11
10:11 Clem_Chong_ left
masak ooh, today is Rakudo release day! 10:13
10:13 Clem_Chong left
frettled \o/ 10:13
masak ...and I still haven't been able to track down why Parrot doesn't like my enums patch... :(
10:14 dalek left, dalek joined, ChanServ sets mode: +v dalek
sorear masak: :$setting = 'CORE' 10:15
masak: you need to pass , setting => "NULL" to use an installed STD if it's not embedded in a context that can provide a CORE 10:16
masak pass setting => "NULL" to STD->parsefile? 10:17
sorear yes
masak and if I want the setting? 10:18
sorear 1. locate a copy of CORE.setting into .
2. modify it as you see fit (optional) 10:19
3. STD->parsefile("CORE.setting", setting => "NULL")
4. use STD->parse as you see fit (but you can't chdir)
masak should be enough for me. 10:21
thanks.
sorear Hah. The .net framework's ReadLine method documents a specific error to be thrown if there are more than Int32.MaxValue characters in the next line 10:23
jnthn masak: github.com/rakudo/rakudo/commit/83b...e38f5920d8 - in the changes to Str.pm, aren't you missing a goto after line 39? 10:24
masak jnthn: looking 10:25
jnthn: yes. 10:26
jnthn: fixing.
jnthn no prizes for guessing what I'm working on. :P
masak :) 10:27
jnthn: (I'm assuming since things are in a git repo, it's OK to modify my contributed code even before my GSoC work has been approved. it won't be part of what I send in, of course.)
jnthn masak: Yes 10:28
masak: I'll be filing this in the next 10 mins or so anyway.
masak Imma let this build finish, then I will push a fix.
pushed. 10:29
lunch & 10:30
dalek kudo: 5b08f4e | masak++ | src/core/Str.pm:
[core/Str] added missing goto in PIR

Discovered by jnthn++.		 10:31
10:39 ruoso left
sorear std: gather take my $l while ($l = self.get).defined; 10:39
p6eval std 32058: OUTPUT«ok 00:01 119m␤»
10:40 achromic left
sorear niecza: 10:48
p6eval niecza 14af68a: ( no output )
dalek ecza: 4770bf5 | sorear++ | lib/ (2 files):
Add $*IN, .lines, .slurp, .get, .getc
 10:51
sorear out
11:00 pmurias joined 11:01 meppl joined, M_o_C left 11:09 Fuad joined 11:12 lestrrat is now known as lest_away
masak rakudo: my $foo = "HAI"; say q"OH $foo" 11:14
p6eval rakudo 5b08f4: OUTPUT«OH $foo␤»
masak :)
Fuad masak :)
hello
how are you?
masak Fuad: hi!
Fuad: now that you're here, I'm excellent!
Fuad: how are you? :)
masak and Fuad privmsg
Fuad im great my friend thanks
i forgot my nickname pass 11:15
go to help they help
sent my pass to email
masak \o/
Fuad :)
[15:59] -NickServ- Last seen : Jun 20 17:25:55 2009 (1 year, 8 weeks, 3 days, 17:34:18 ago)
before army
:)
masak I'm so glad you survived. 11:17
Fuad thank you my bro
11:25 pmurias left 11:32 [Coke] joined 11:36 rgrau joined
takadonet morning all 11:46
masak takadonet: \o 11:48
11:59 envi^home joined 12:01 Fuad left 12:05 rgrau_ joined 12:06 rgrau left 12:21 azert0x joined 12:23 TiMBuS left, TiMBuS joined 12:24 azert0x_ joined 12:25 azert0x left 12:29 drbean joined 12:30 rgrau_ left, rgrau_ joined 12:35 patrickas joined 12:36 NiiHiiL joined, ruoso joined 12:40 jaldhar left 12:41 Guest41392 left, Trashlord joined, jfried left 12:43 jaldhar joined 12:46 jferrero joined
jferrero rakudo: say <A C> X <G T> 12:47
p6eval rakudo 5b08f4: OUTPUT«AGATCGCT␤»
jferrero rakudo: say <A C T G> X <A C T G> 12:48
p6eval rakudo 5b08f4: OUTPUT«AAACATAGCACCCTCGTATCTTTGGAGCGTGG␤»
masak rakudo: say <A C T G>.pick(30, :replace) 12:49
p6eval rakudo 5b08f4: OUTPUT«CTGGATTCCGCTGCCGGTACACGAGTGGCT␤»
12:51 xinming left 12:52 xinming joined
jferrero masak: What is the join() equivalent at Perl v6? 12:56
masak rakudo: say join '|', <a b c> 12:57
p6eval rakudo 5b08f4: OUTPUT«a|b|c␤»
masak it's the same, if you want.
jferrero Ok
masak there's also a method form.
rakudo: say <a b c>.join('|')
p6eval rakudo 5b08f4: OUTPUT«a|b|c␤»
jferrero rakudo: say join '-', <A C T G> X <A C T G>
p6eval rakudo 5b08f4: OUTPUT«␤»
masak jferrero: precedence.
rakudo: say join '-', (<A C T G> X <A C T G>) 12:58
p6eval rakudo 5b08f4: OUTPUT«A-A-A-C-A-T-A-G-C-A-C-C-C-T-C-G-T-A-T-C-T-T-T-G-G-A-G-C-G-T-G-G␤»
jferrero 10x, masak
OOps
no
masak you're "w11come"
jferrero I need pairs of permutations
12:58 tadzik joined
bbkr rakudo: say join '-', (<A C T G> X <A C T G> X <A C T G>) # checking if it's implemented 12:59
p6eval rakudo 5b08f4: OUTPUT«No applicable candidates found to dispatch to for 'infix:<X>'. Available candidates are:␤:(Any $lhs, Any $rhs)␤␤ in main program body at line 22:/tmp/HTeh2GJGVk␤»
moritz_ rakudo: say (<A C T G> X=> <A C T G>).perl
p6eval rakudo 5b08f4: OUTPUT«("A" => "A", "A" => "C", "A" => "T", "A" => "G", "C" => "A", "C" => "C", "C" => "T", "C" => "G", "T" => "A", "T" => "C", "T" => "T", "T" => "G", "G" => "A", "G" => "C", "G" => "T", "G" => "G")␤»
moritz_ better?
jferrero Sorry... I need: AA-AC-AT-AG ... 13:00
masak a mere &map away :)
moritz_ rakudo: say (<A C T G> X~ <A C T G>).join('-')
p6eval rakudo 5b08f4: OUTPUT«AA-AC-AT-AG-CA-CC-CT-CG-TA-TC-TT-TG-GA-GC-GT-GG␤»
jferrero Ole!
moritz_ masak: don't forget we have these meta operators... :-)
masak moritz_++ 13:01
jferrero Thanks, moritz_ && masak 13:02
masak .oO( I'm lucky moritz_ evaluates to a true value... ) 13:03
tadzik :)
jferrero hahaha
:)
13:07 blogometer joined 13:09 orafu left, orafu joined 13:12 Holy_Cow joined 13:14 lest_away is now known as lestrrat
bbkr rakudo: sub infix:<M>(Int, Int) {666}; (<1 2> XM <1 0>).perl.say # known bug? 13:14
p6eval rakudo 5b08f4: OUTPUT«===SORRY!===␤Could not find sub &infix:<M>␤»
cognominal do meta operators work on methylated chains? :)
13:15 kaare_ left 13:17 pnate left
moritz_ bbkr: yes; currently only works with 'our' operator subs 13:24
needs lift
bbkr moritz_++ 13:25
13:25 jferrero left 13:28 NiiHiiL left 13:30 snearch left 13:35 javs joined 13:41 burmas joined 13:44 pmurias joined
pmurias ruoso: hi 13:44
13:44 Guest23195 joined, _madmax_ left 13:45 takadonet left 13:48 Fuad joined, takadonet joined
pmurias ruoso: did you evaluate my GSoC project? 13:48
ruoso hi pmurias 13:51
yes... I did...
yes... I gave you a pass ;) 13:52
masak \o/
13:52 pmurias left
moritz_ \o/ 13:52
ruoso in fact, when I looked at the original proposal I was impressed as how close the actual work was to the initial plan
Fuad )
pmichaud good morning, #perl6 13:53
rakudo: say Nil.defined # checking
13:53 uniejo left
p6eval rakudo 5b08f4: OUTPUT«1␤» 13:53
pmichaud :-(
masak "Day 2673: woke up. Nil is still defined. dang" 13:54
pmichaud I thought I undefined it last night.
13:54 pmurias joined
pmichaud pmichaud@plum:~/rakudo$ ./perl6 13:55
> say Nil.defined
0
masak "local variations may occur"
moritz_ pmichaud: ship it
pmichaud # Your branch is ahead of 'origin/master' by 1 commit.
moritz_ pmichaud: erm, I mean, push it, let mathw++ ship it :-)
pmichaud oh.
masak :)
pmichaud looks like I didn't push.
(was tired last night)
masak that's becoming a bit of a theme, isn't it?
pmichaud pushed. 13:56
masak pmichaud++
pmichaud (theme) being tired at night? yes. :-P
moritz_ pmichaud: don't forget to push chagned tests, if any?
pmichaud I know that I did commit those.
masak those just need the committing :)
moritz_ masak: ... unless you use git-svn 13:57
masak right-o.
which I should.
pmichaud r32057 and r32058
dalek kudo: 3f0bfbb | pmichaud++ | src/ (4 files):
Switch Nil to be an undefined Parcel constant.
kudo: 1f5a79f | pmichaud++ | / (4 files):
Merge branch 'master' of github.com:rakudo/rakudo
masak nono, you should 'git pull --rebase' :S 13:58
then you won't get those ugly unnecessary merge commits. 13:59
it's as if you were developing in a branch all the time.
moritz_ has a script called 'update-stuff' which chdirs do a couple of project folders, and calls 'git pull --rebase' or 'svn up' in them
masak I'm with Linus on when to merge and when to rebase: www.mail-archive.com/dri-devel@list...39091.html 14:01
(short story, almost always rebase)
moritz_ unless there's a reason for you to tell the world you did a merge
like, a branch that broke things inbetween
masak right. 14:02
pmichaud reads Linus' note
masak merge is a safe, but often unnecessary default.
Fuad moritz_: no way
moritz_ Fuad: context? 14:04
masak was wondering about that, too
pmichaud Hmmm... I don't get from Linus' message to "use git pull --rebase". 14:05
x3nU how do i build rakudo to certain directory?
(rakudo star ofc)
moritz_ pmichaud: that's the "clean" part
14:05 wtw left
pmichaud x3nU: --prefix=<installdir> on Configure.pl 14:05
x3nU thanks 14:06
moritz_ pmichaud: there's no need to expose your merging commits when git pull'ed instead of git pull --rebase'd
14:06 Fuad left
masak pmichaud: 'git pull --rebase' is just a shortcut command to follow the general advice in that post. 14:06
pmichaud: there are other ways not to cause merges.
14:07 drbean left
PerlJam sets git config branch.autosetuprebase always 14:07
of course, I also have a "pullr" alias for "pull --rebase" 14:08
masak ooh
14:10 azert0x_ left
masak pmichaud: I submitted the enums segfault as a parrotbug. trac.parrot.org/parrot/ticket/1746 -- as opposed to one month ago, there are now repeatable conditions for triggering the segfault. 14:13
pmichaud masak: yes, I just saw the ticket 14:14
good choice
masak hope it'll lead to some unstuckness. 14:15
moritz_ you usually get that when you troll #parrot enough :-)
masak is that a specific, second-person singular 'you', or the general pronoun which is synonymous with 'one'? :) 14:17
moritz_ the latter
[particle] one usually gets that when you troll #parrot
masak oh, ok :)
[particle]: lol
moritz_ apologizes for the amibguties in the English language 14:18
[particle] what would puns be without ambiguities?
masak you don't need to apologise for ambiguities you didn't create. :) 14:19
[particle] s/you/one/
moritz_ [particle]: puns don't require ambiguities at all
similarity is enough
PerlJam I thought ambiguity was a feature
pmichaud notices that the core of ambiguities is "gui". Hmmmmmmm.
[particle] some do, but they're better spoken than read 14:20
masak "You don't have to be ambiguous to be a pun here... but it helps!"
moritz_ or phrased another way, ambiguity is not a pundamental problem :-)
masak pmichaud: in Mandarin, 鬼 GUI3 means "devil". ":) 14:21
moritz_++
PerlJam masak: so ... ambiguity is a two handed devil?
pmichaud rakudo: say Nil.defined # yet?
p6eval rakudo 5b08f4: OUTPUT«1␤»
pmichaud :-(
tadzik 0 here :) 14:22
masak "Day 2673, later: Nil is still defined. dang"
moritz_ 15 */2 * * * perl /home/p6eval/rebuild-rakudo.pl >> /home/p6eval/rakudo-build.log 2>&1
so the rebuild should be running
pmichaud The future is here, it's just unevenly distributed.
moritz_ (server clock is in UTC)
rakudo: say Nil.defined 14:23
p6eval rakudo 5b08f4: OUTPUT«1␤»
tadzik (:
moritz_ uhm. Something went wrong, it seems
masak something undefined went wrong...
moritz_ Confused. 14:24
why does it rebuild parrot? it should have a sufficient version available already
mathw Could somebody please look at ChangeLog and 2010.08 announcement and fix things they discover are wrong about new features/changes/anything else?
moritz_ seems the rebuild script is a bit broken
mathw I've probably got something wrong in there
masak of course, in Mandarin 'gui' could also mean 'noble', 'turtle', 'silicon', or 'salmon'. 14:25
mathw: looking
jnthn masak: Wow. Another upside to not liking fish is that I won't accidentally order devil in a Chinese restaurant. :-) 14:26
PerlJam nor turtle
moritz_ + smartmatch against True or False is now an error
that's more of a bug than a feature, fwiw 14:27
it should just warn
jnthn mathw: Taking a look
mathw moritz_: the commit said it should be a .worry later
moritz_ but the ChangeLog looks good
mathw I think it was .worry
but it's definitely an error right now
unless the comments are wrong :)
in which case it's ALL SOMEONE ELSE'S FAULT 14:28
moritz_ rakudo: say 1 ~~ True
p6eval rakudo 5b08f4: OUTPUT«===SORRY!===␤Smartmatch against True always matches; if you mean to test the topic for truthiness, use :so or *.so or ?* instead at line 22, near " True"␤»
moritz_ hm
Carl Masäk, Jonathan Worthington, Bruce Gray, Patrick Abi Salloum, 14:29
isn't that wrong? :-)
pmichaud the point is that someone shouldn't be smart matching against True/False
moritz_ Mäsak instead?
pmichaud: yes. And still it's wrong to die.
pmichaud right. but die is better than no warning at all.
jnthn moritz_: Something doens't look quite right there. :-) 14:30
14:30 burmas left
mathw forgive me, I was asleep 14:31
jnthn and it was an excellent
location for hackathon and planning the next states of Rakudo
development.
"a hackathon"
alester I should probably update the Perl code in xoa.petdance.com/Songs_in_code into Perl 6.
jnthn "next stages"
?
Or phases ;-) 14:32
moritz_ phasers!
dalek kudo: ee31f3d | moritz++ | docs/announce/2010.08:
[announce] those diacritics are easy to mis-remember :-)
 14:33
jnthn It's direly critical to get 'em right. 14:34
mathw groan
masak I almost never get them wrong. don't see what the fuss is all about. :)
14:34 pyrimidine joined
mathw 'almost never' 14:34
for your own name?
masak ok, so never.
14:34 pmurias left
masak I meant to cushion the blow a little. :) 14:35
mathw meh 14:36
I can't even spell my own name some days 14:37
and it doesn't have any diacritics or anything in it
masak mathw: I read the release announcement. it looks good to me.
mathw \o/
especially now moritz++ fixed it
I'll bundle up a tarball this evening
14:39 azert0x joined
dalek kudo: 4f1dee5 | pmichaud++ | docs/announce/2010.08:
Add note about Nil now being undefined.
 14:39
kudo: 90637b6 | jnthn++ | docs/announce/2010.08:
Tiny tiny tweakies.
14:43 rgrau__ joined 14:44 rgrau_ left, rgrau__ is now known as rgrau
pmichaud rakudo: say Nil.defined; 14:46
p6eval rakudo 90637b: OUTPUT«(timeout)»
moritz_ rakudo: say Nil.defined; 14:47
masak the excitement is unbearable!
p6eval rakudo 90637b: OUTPUT«(timeout)»
moritz_ 14:26:21 up 309 days, 2 min, 0 users, load average: 2.27, 1.45, 1.07
pmichaud Looks like it's impossible to undefine Nil. Change the spec. :-P
masak nooooo
moritz_ that's not too bad with 4 CPUs
14:48 foodoo left
moritz_ rakudo: say Nil.defined 14:51
p6eval rakudo 90637b: OUTPUT«0␤»
moritz_ \o/
pmichaud \o/
masak \o/
moritz_ rakudo: say ().defined
p6eval rakudo 90637b: OUTPUT«1␤»
pmichaud \o/
masak \o/
moritz_ rakudo: {}.().defined
colomon \o/
p6eval rakudo 90637b: OUTPUT«invoke() not implemented in class ''␤ in main program body at line 22:/tmp/G5dkZGZSTS␤»
masak moritz_: that's a hash.
moritz_ rakudo: {;}.().defined
p6eval rakudo 90637b: ( no output ) 14:52
moritz_ masak: I figured
pmichaud rakudo: sub xyz { }; xyz().defined.say
moritz_ rakudo: print {;}.().defined
p6eval rakudo 90637b: OUTPUT«0␤»
rakudo 90637b: OUTPUT«0»
pmichaud rakudo: sub xyz { return; }; xyz().defined.say
p6eval rakudo 90637b: OUTPUT«0␤»
masak rakudo: say (class {}).?foo.defined
pmichaud rakudo: sub xyz { return(); }; xyz().defined.say
p6eval rakudo 90637b: OUTPUT«0␤»
masak \o/
pmichaud rakudo: sub xyz { return (); }; xyz().defined.say
p6eval rakudo 90637b: OUTPUT«1␤»
pmichaud looks good to me. :-) 14:53
moritz_ and it seems to work. Frabolous
masak Twicked!
jnthn rakudo: my $x; say ($x.?lol-i-am-nonexistant).defined
p6eval rakudo 90637b: OUTPUT«0␤» 14:54
jnthn \o/
pmichaud++
masak TimToady_++
jnthn Yes, TimToady_++ too
I'm happy we've ended up^W^Wnow swung this way. :-) :-)
pmichaud rakudo: sub xyz { }; say xyz() ~~ Nil; 14:55
p6eval rakudo 90637b: OUTPUT«1␤»
masak "Perl 6 spec: we're happy we've now swung this way"
pmichaud hugme tweet rakudoperl Nil is now undefined. #perl6
hugme hugs pmichaud; tweet delivered
masak rakudo: say Nil ~~ Nil
p6eval rakudo 90637b: OUTPUT«1␤» 14:56
masak rakudo: say Nill ** 2 ~~ Nil
p6eval rakudo 90637b: OUTPUT«===SORRY!===␤HyperWhatever (**) not yet implemented at line 22, near " 2 ~~ Nil"␤»
masak oops.
moritz_ rakudo: say () ~~ Nil
masak rakudo: say Nil ** 2 ~~ Nil
p6eval rakudo 90637b: OUTPUT«0␤»
moritz_ rakudo: Nil ~~ ()
p6eval rakudo 90637b: ( no output )
moritz_ rakudo: say Nil ~~ ()
p6eval rakudo 90637b: OUTPUT«1␤»
masak \o/
Juerd HyperWhatever is an interesting name 14:57
masak "Nil: an empty Parcel with pieces of flair"
pmichaud actually, Rakudo implements it as a type. :-)
masak yeah, but the truth is so boring. :)
pmichaud that may end up being wrong, but Nil seems to act more like a type than not-a-type
more precisely, Nil seems to act more like a type object than anything else :) 14:58
Juerd finds "type object" hard to grok
masak Juerd: we just need to work more on the 'grok' tool, then :) 14:59
pmichaud Juerd: it's the object that represents the type
14:59 redicaps joined, redicaps left
pmichaud or I suppose it's "an object that represents a type" 14:59
Juerd I know what it is but it's too abstract
pmichaud I think "abstract" is what it's designed for :-P
PerlJam Juerd: blogs.perl.org/users/ovid/2010/08/w...stems.html 15:00
:-)
Juerd PerlJam: Thanks, I'll read that
jnthn Juerd: The implementation of it turns out to be quite straightforward if you get the right factoring, fwiw. :-)
15:01 pyrimidine left, pyrimidine joined 15:03 justatheory joined, justatheory left 15:04 justatheory joined
moritz_ Is the implementation concrete? :-) 15:05
szbalint It seems solid. :) 15:07
jnthn moritz_: Yes, but it's still setting. :-) 15:08
pmichaud ...what to work on today...? 15:10
moritz_ pmichaud: nulling temporaries in PCT generated code 15:11
pmichaud: or splitting the setting
colomon pmichaud: two quick questions: what's the state of your series refactor?
pmichaud: and what would it take to redo the gather iterator ala the range iterator? 15:12
15:16 justatheory left
masak rakudo: class A {}; grammar G is A { regex TOP { foo } }; G.parse("foo") 15:20
p6eval rakudo 90637b: OUTPUT«Method 'parse' not found for invocant of class ''␤ in main program body at line 22:/tmp/uV6YGgoaqT␤»
masak I know, that's a bit of "doctor, it hurts when I do this"...
moritz_ masak: I'd say it's a bug. 'grammar' should add Grammar to the list of its parents, unless one of the explicit parents is Grammar already 15:22
at least I think that's what it should do.
masak oh, good.
masak submits rakudobug
moritz_ and I know where to fix it 15:23
src/metamodel/GrammarHow.pir around line 41 15:24
jnthn :-)
Yes, that's HOW.
moritz_ MEH
masak YOW
moritz_ if it were written in Perl 6, I'd say if none(@parents>>.isa(Grammar)) { $P0.add_parent(Grammar, $P0) } 15:25
jnthn It'll be written in NQP at some point. 15:26
masak that's pretty.
or 'unless any(...)'
moritz_ jnthn: how hard would it be to rewrite it now?
(no, I don't want to do it before the release... ) 15:27
15:27 azert0x left
jnthn moritz_: Probably quite easy. 15:28
Though a bit messy, since for now you'd still need pir::foo I guess 15:29
pmichaud 15:11 <colomon> pmichaud: two quick questions: what's the state of your series refactor? 15:32
I abandoned it for now. I think I'm going to wait for the spec to settle down there a bit. 15:33
15:33 azert0x joined
pmichaud patrickas++ has some improvements for series, and I'm thinking those can be applied at some point. 15:33
15:12 <colomon> pmichaud: and what would it take to redo the gather iterator ala the range iterator?
TimToady_ yes, the default behavior for stringy ... is likely to take into account the endpoint
15:34 risou joined
pmichaud afaict, the gather iterator is about what it should be... I'm not sure how it would be "re-done" like the range iterator. 15:34
colomon patrickas also has been working on a series refactor, too, with a bit of help from me. But it doesn't seem like a very big win so far.
pmichaud colomon: I think the spec for series itself needs a bit of a cleanup. it feels... contradictory at times.
I could probably come up with a revised draft 15:35
not changing any of the core semantics, just how it's described
cognominal discovers the inspect opcode
pmichaud 15:11 <moritz_> pmichaud: or splitting the setting
colomon pmichaud: for gather, I was thinking of something like returning multiple results at a time. I'm suspicious it's a big drag on Rakudo's timing at the moment. but don't have anything like proof.
15:35 meppl left, rgrau_ joined
pmichaud colomon: I suspect gather needs to be as lazy as possible. 15:35
colomon pmichaud: as for series, yeah, the spec is somewhat painful at the moment. 15:36
cognominal almost said "/me inspects the discover opcode"
moritz_ rakudo: say Grammar.isa(Grammar)
p6eval rakudo 90637b: OUTPUT«1␤»
pmichaud 15:11 <moritz_> pmichaud: or splitting the setting
moritz_: I've worked on that a bit, but it's definitely non-trivial.
15:37 rgrau left
pmichaud also, at the moment core.pm is my primary compilation benchmark, so I'm thinking I'll want to keep it as-is for another week or so while I try to improve parsing/compiling speed overall. 15:37
colomon pmichaud: perhaps a better approach might be to look at removing use of gather from some of the core functionality, then? I might play around with a few simple things just to see what sort of difference it makes.
pmichaud colomon: that can work (more) 15:38
colomon pmichaud: I'm particularly thinking of IO.lines at the moment.
pmichaud colomon: well, that's another one that wants strict laziness, though.
15:38 pmurias joined
pmurias ruoso: ping 15:38
jnthn cognominal: Don't get too into it. :-) 15:39
15:39 perlygatekeeper joined
colomon pmichaud: huh? I'd think exactly the opposite, isn't the internal file buffer likely to be loading more than one line at a time anyway? 15:39
jnthn cognominal: Anything you write that depends on it now is likely to break when the new meta-model stuff lands.
TimToady_ lines doesn't want strict laziness; that would be death for performance
pmichaud colomon: well, if you're going to have the IO object do buffering, then yes.
jnthn cognominal: And the info is already available through .^foo methods anyway. 15:40
pmichaud TimToady_: what about
pmurias lue, sjohnson: perlito has a js backend, with a (fair) bit of hacking it could be made usefull enough to avoid having to write js
moritz_ colomon: depends on wether we allow .get after an aborted .lines() iteration
pmichaud for $IO.lines { ... }
15:40 takadonet left
pmichaud where there's a 'last' in the loop 15:40
TimToady_ the abstraction isn't supposed to leak batchiness
you can reify ahead of time
pmichaud right, so the IO object can batch up some lines, but its iterator has to deliver/consume them lazily 15:41
in that case, there can indeed be some batching going on
15:41 achromic joined
TimToady_ the IO object *is* the iterator in this case, meseemeth 15:42
colomon the idea that you might do $IO.lines, only get part of the lines, and then expect $IO.get to return the next one seems very wrong to me.
TimToady_ it doesn't have to clone an iterator like an array does
pmichaud TimToady_: that can work also, yes.
TimToady_ in any case, if you want that, we can pessimize declaratively 15:43
15:43 takadonet joined
TimToady_ or at least openly 15:43
IO objects should have methods to tweak these things
but the default on input needs to be blazing fast 15:44
pmichaud colomon: it's pretty clear (to me at least) that
for lines() { ... }
needs to be such that lines() doesn't consume all of the input
otherwise we won't be using 'for' to iterate IO 15:45
moritz_ wow. I wrote about 15 lines of PIR, and didn't even get a compiler error 15:47
and it didn't error out either
moritz_ scared of himself
colomon when you say, "consume" do you mean actually or logically? I'm certainly not proposing to read the entire file when you call .lines. But I am proposing that if you call $IO.lines, you should not no longer expect $IO.get to give you something meaningful. It seems to me you shouldn't expect to mix the two.
pmichaud colomon: I'm disagreeing with your proposal. (more)
TimToady_ I think $IO.get can be consistent, but the file pointer won't 15:48
pmichaud # read file until we see '-----'
for lines() { last if $_ eq '-----'; }
# should be able to do $*ARGFILES.get here
TimToady_ a get should work after that
15:48 tadzik left
TimToady_ both constructs are just shifting (and rebatching at need) 15:49
pmichaud agreed.
that's what I mean when I say that "lines()" needs to be "lazy"
TimToady_ so it's shift that needs to be low overhead
in p5, shift just bumps the front pointer of the array and returns the bumpee
pmichaud lines() can't logically consume all of the input from the IO object when it's invoked
TimToady_ since it could be infinite 15:50
pmichaud shift can be low-overhead when the internal iterators batch things up, yes.
I'm thinking of adding an argument to .reify to say "please reify at least $n elements"
wolverian do we have a lines().take-until('------')? :)
pmichaud (if you can)
TimToady_ tries to think of uses for lines on /dev/random
wolverian (or * eq '------')
TimToady_ where reify * means "you pick a good batch size" 15:51
PerlJam wonders if we somehow get tail for free now
TimToady_ this is something the source is likelier to have a good idea of than the sink
15:52 tylercurtis joined
TimToady_ and in the case of decoding a buffer, the size might actually vary 15:52
pmichaud wolverian: lines().map({ last when '-----' }) # maybe
wolverian pmichaud: but haskell has takeUntil (and takeWhile), so surely we should too. :) 15:53
TimToady_ just so they aren't spelled like that, shudder...
PerlJam wolverian: perhaps that's part of Haskell::Utils
wolverian TimToady_: I used take-until. maybe that's not as bad...
TimToady_ well, take is wrong in Perlland as well 15:54
colomon So is this legal? for $IO.lines -> $line { $i++; $IO.get if $line ~~ /blueberry/; }
wolverian PerlJam: I guess it depends on how important lists are.
pmichaud colomon: iiuc, yes, that's legal.
replace $IO with $*IN and you'll see why :-) 15:55
(although arguably the $*IN case might want to be a 'while' anyway)
colomon I dunno. My gut feeling is that is a terrible idea.
Juerd So "lines" is the plural of "get"?
:P 15:56
colomon It's not like using $IO.get explicitly all the time is terribly hard.
Juerd i.e. Why isn't .get called .line? :)
moritz_ I have a patch for the grammar A is NonGrammar { } thing. It doesn't break anything. Sadly it doesn't seem to fix anything either :(
pmichaud colomon: rewrite what you just wrote using .get, then.
colomon while my $line = $IO.get { $i++; $IO.get if $line ~~ /blueberry/; }
pmichaud what if $I0.get returns "" ? 15:57
then the loop fails early.
moritz_ then you're screwed :-)
wolverian that looks positively five-ish :)
TimToady_ which is why p5 didn't autochomp
15:57 pyrimidine_ joined
colomon and of course, there's the other way 15:57
moritz_ I thought p5 rewrote that internally to while (defined my $line = ...) ? 15:58
TimToady_ a workaround to a hack :)
moritz_ evil compiler magic and all
15:58 McFist joined
colomon my $lines = $IO.lines; while defined my $line = $lines.shift { $i++; $lines.shift if $line ~~ /blueberry/; } 15:59
pmichaud we've struggled pretty consistently to say "if you want to iterate something, use 'for'" -- it would be sad if we then had to add "but not file I/O".
15:59 blogometer left
colomon but you don't use for if you might want to use more than one thing in for list at once. 15:59
pmichaud I don't follow that. 16:00
TimToady_ metoo
McFist just found out that parameters in subs are read-only by default, is that true? seems very unthoughtful to me
colomon there's no for @a { $i++; magically skip next element of @a if $_ %% 3; }
PerlJam McFist: why? 16:01
colomon (or at least, there's nothing like that I'm aware of.)
pmichaud colomon: right, but @a isn't being "consumed", either.
[particle] for @something -> $x, $y { if $x < 3 say $y else unshift @something, $y }
16:01 pyrimidine left, pyrimidine_ is now known as pyrimidine
wolverian next :twice; 16:01
pmichaud colomon: I mean, @a still has its values when the list is done.
TimToady_ McFist: default copy semantics are higher overhead
[particle] ^^pseudocode
colomon gotta go, but still not at all happy with this. 16:02
pmichaud colomon: understood. I'm just following the language spec (as I understand it).
McFist TimToady_: true, but that problem could be fixed by "$a is rw" if the programmer cares about that (on modern processors esp.)
pmichaud colomon: for changes, you'll have to talk to the One Who Torments Implementors.
TimToady_ next if $prev %% 3 16:03
McFist PerlJam: just seems more natural, in my experience
masak McFist: the problem *is* fixed that way. I'm not sure I see what you're arguing against.
PerlJam McFist: you always utilize $_[$n] in Perl 5?
pmichaud masak: I think McFist wants the default to be 'is copy'
McFist PerlJam: very rarely, why?
NO! 16:04
PerlJam McFist: because that's what it sounds to me like you're asking for.
McFist i've read that the default is "is copy", and asked if that's true
pmichaud the default is "is readonly"
McFist ups sorry
yes, I want the default "is copy", sorry again
masak McFist: making the conservative option (in time as well as side effects) the default seems right to me.
pmichaud "is copy" means more runtime overhead
McFist pmichaud: yes, but that can be sured by "is rw" 16:05
cured, even
PerlJam (side-effect free code)++
pmichaud McFist: we'd like the defaults to be fast
not only that, but "readonly" is a safer default
patrickas pmichaud: speaking of "is copy" i got rid of the "is copy" in the series refactor :-)
masak we'd also like to make a sane cultural choice the default. 16:06
pmichaud if you're going to write to a parameter, you should declare what sort of 'write' you want to be doing.
TimToady_ when someone says "$param = 42", we force people to think about whether they mean "rw" or "copy"
otherwise we'll have people assuming the wrong one all the time
McFist i can't argue about the speed, but the sane cultural choice seems to me "is rw"
pmichaud ouch 16:07
TimToady_ eh? Fortran semantics? no way
pmichaud that means you can inadvertently be modifying the caller's arguments
masak no thanks.
pmichaud that's not a good default.
McFist well, I'm being misunderstood, not caller aguments in @_ style
just not readonly
pmichaud that's what "is rw" means.
McFist not necessarily
masak but this is all a moot point, because programmers who want that default are quite welcome to set it with a pragma.
pmichaud ("is rw" == caller arguments can be modified) 16:08
PerlJam McFist: so you do want "is copy"?
McFist PerlJam: I guess so
PerlJam McFist: same as sub foo { my ($alpha,$beta) = @_; ... } in perl 5/
?
McFist unless there's no saner behavior , something between copying the scalar always and, well, not copying it
[particle] what about "is dangerous"?
McFist PerlJam: yes, like that 16:09
and without modifying the caller's args
without $_[$a]++ that can backfire
TimToady_ we already gave two reasons why 'is copy' isn't the best default 16:10
McFist I mean, I buy the speed argument and buy $_[$n] argument, but default readonly seems an overkill
PerlJam McFist: uh oh ... you're pushing the wrong buttons now ... How is "is ro" overkill? Explain that.
TimToady_ we want to know what the programmer means by "$param = 42", not just guess
moritz_ action at a distance is evil.
it's a good idea to make the programmer declare it if he wants it 16:11
McFist I mean, semantic overkill - I just want sub f($a){f($a--)} to figure automatically that $a stays on the stack 16:12
pmichaud o_O
TimToady_ what if the intent was to change the caller's parameter?
s/parameter/argument/
TiMBuS is ref
moritz_ McFist: maybe you want to program in Forth instead?
pmichaud why would you do $a-- there?
moritz_ if you care about the stack
McFist TimToady_: which not happens often, then I guess a special "is" flag suffice? like, "is i_want_to_modify_caller" ? :)
masak the code analyzer that I haven't written yet also wants the default to be 'is readonly'.
16:13 smash_ joined
smash_ hello everyone 16:13
[particle] that's not a very strong argument, masak
PerlJam McFist: I think you're in the camp of "wants readonly but doesn't know it yet" :)
McFist pmichaud: just an illustration, c-style if you want
pmichaud "is i_want_to_modify_caller" already has a flag, it's "is rw"
masak [particle]: no, because it caters to the computer rather than to the user. but it's worth remembering. 16:14
[particle]: were the default 'is rw', there'd be lots of actions-at-distances that I might not be able to rule out.
huf but... but... default is readonly caters to the user too ;)
McFist pmichaud: can be there such "is rw" that, well, just rw, and doesn't modify the caller?
moritz_ McFist: if you use recursion, you probably just want sub f($x) { f($x-1) } instead
huf McFist: is copy?
pmichaud McFist: there is... it's "is copy"
PerlJam McFist: wait ... sanity check: do you also want variables to be auto-declared per scope (i.e. get rid of "my") ?
masak huf: right. but it does so by being a bit strict.
huf masak: bondage is good!
McFist PerlJam: no, why? 16:15
masak huf: in this case, it leads to some good things.
huf masak: especially as perl always leaves a loophole open ;)
16:15 blogometer joined
huf so you're never truly bound 16:15
McFist moritz_: not the best example, pls don't mind recursion
masak huf: there's always a 'safe word'?
:)
huf ;) yeah
PerlJam McFist: because it's another area where people think the "saner default" is to do something implicit rather than explicit.
McFist: those people would be wrong :) 16:16
McFist yeah, but
do I undrestand correctly that the only argument agains default "is copy" is runtime overhead?
jnthn Not at all
TimToady_ no
PerlJam McFist: nope
TimToady_ we want to know what the programmer means by "$param = 42", not just guess
that's the other argument 16:17
McFist TimToady_: why? and who're we here?
[particle] repeat that a few more times.
TimToady_ we want to know what the programmer means by "$param = 42", not just guess
McFist sorry I didn't get that from 1st time
moritz_ we want to know what the programmer means by "$param = 42", not just guess
PerlJam heh
moritz_ (maybe it helps if more people say it? :-)
masak we want to know what the programmer means by "$param = 42", not just guess
McFist moritz_: do you really think so? 16:18
pmichaud 16:06 <pmichaud> if you're going to write to a parameter, you should declare what sort of 'write' you want to be doing.
TimToady_ "we" is anyone or anything who cares
moritz_ McFist: indeed
16:18 justatheory joined
TimToady_ but esp the compiler 16:18
moritz_ and the test suite maintainer
jnthn Or anyone trying to ready/understand the code.
*rad
*read
TimToady_ and the language designer, who often uses "we" to mean "I" :)
masak tries to rad some of his code sometimes 16:19
McFist well, ok , you want it but why??
PerlJam TimToady_: link him to your doc on natural language principles. (I don't have it handy or know it right off)
moritz_ McFist: do you want to understand code you read?
PerlJam :)
TimToady_ well, there are two reasons, and you're turning into a troll
16:19 risou_ joined 16:20 McFist left
rokoteko pmichaud: mind if I am a bit nosy. "I'm not really after all of the people who program in Perl 5 and are happy with it" .. why not? 16:20
masak McFist: please be more specific than 'why??' that sounds like you didn't understand the last ten minutes of conversation at all.
16:20 McFist joined
McFist sorry 16:20
masak McFist: please be more specific than 'why??' that sounds like you didn't understand the last ten minutes of conversation at all.
PerlJam ah, found it.
moritz_ rokoteko: I'm not pmichaud... but going for people who are happy with their current programming language
McFist sorry if I look like trolling, I'm not
moritz_ ... is just inefficient
PerlJam McFist: Language design is hard. See www.wall.org/~larry/natural.html
McFist it's hard to answer 5 people in parallel ) 16:21
16:21 justatheory left, risou left
rokoteko moritz_: Erm. But it's perl. So you are one of those people who think that perl5 and perl6 are completely different languages? 16:21
moritz_ rokoteko: it's much easier to convince people who are searching for something better
pmurias McFist: the reason "is readonly" is the default is that we want to protect people against accidently modifing the variable
rokoteko moritz_: if you are happy with perl5, you cant be excited about perl6?
moritz_ rokoteko: no. I think they are different languagages, and both are perl
pmichaud rokoteko: because if I say to myself "how do I make Perl 6 successful", I see that I can either try to convert Perl 5 programmers, or I can go after people who don't yet program or don't yet program in Perl
McFist masak: well to be more precise: "why we (e.g. compiler if I understand Larry correctly here) what to know what programmer means by $x = 42"? 16:22
pmurias * modifiying
pmichaud I think the latter group is where the bigger win is
McFist PerlJam: thanks
pmichaud McFist: no, not the compiler
PerlJam McFist: the compiler wants to know so that it can generate the appropriate instructions
masak McFist: because depending on what you mean, the assignment could either affect or not affect the caller environment.
moritz_ rokoteko: sure. I got excited about Perl 6 when I was a Perl 5 programmer, and liked it. But there's not much to win if you try to convince die-hard p5 fans like Abigail
PerlJam McFist: the humans want to know so that they can have a reasonable chance at understanding the program
masak McFist: with 'is copy', it doesn't affect the caller, with 'is rw' it does. 16:23
pmichaud the compiler could figure it out. it's the other people reading the code that we want to clarify for
McFist pmichaud: well, but who then, the design team?
pmichaud McFist: other programmers
McFist pmichaud:programmers like in "fellow programmers" or the perl6 design team?
TimToady_ pmichaud: I don't think the compiler can figure that out in many cases
moritz_ rokoteko: or die-hard fans of any programming language. Either they are amazed by what they see of Perl 6, or not. If not, leave them alone. You won't make them happy by intruding their language choice
PerlJam McFist: Perl 6 programmers.
rokoteko pmichaud: hm. interesting point. Im not that familiar with marketing. 16:24
pmichaud rokoteko: it's part of being a "disruptive technology" (more)
PerlJam McFist: programmers in general too, but they'll have a tougher time at it if they don't already know perl :)
moritz_ and you won't make yourself happy either, because they'll keep comparing p6 to their old love, and moan that things are different
TimToady_ however, to the first approximation, the sample of Perl 6 programmers we have is the design team :)
McFist well I do :)
TimToady_ rakudo star is all about trying to broaden that sample 16:25
PerlJam moritz_: Love isn't a zero-sum game. You can make more of it. It's too bad people treat it otherwise sometimes. :(
pmichaud rokoteko: disruptive technologies often start out by targeting "markets" that the existing technologies ignore or discount
rokoteko: or, I can put it another way (more) 16:26
McFist well, I didn't buy the second argument then "we want to know what programmer means by $x = 42", because perl5 could do that without default readonly
moritz_ PerlJam: yeah, but love != die-hard fanboyism
rokoteko pmichaud: nods. well (to me) your post just made perl6 sound like perl5 for dummies. ;)
pmichaud rokoteko: which is larger -- the base of programmers that exists today, or all of the yet-to-be-programmers that will come up in the next 20-30 years?
tylercurtis McFist: that's because in Perl 5, you can't have readonly parameters.
TimToady_ McFist: only by forcing the user to make a copy
moritz_ McFist: perl5 doesn't have parameters
McFist true
moritz_ so $param = 42 never occurs in p5
patrickas rakudo: my @a=1,2,3,4,5,6; say @a[*-3 .. *-1];
McFist also true
moritz_ unless you copied to it first
p6eval rakudo 90637b: OUTPUT«4111111111111111␤»
McFist but wouldn't it be great if it would in perl6? 16:27
moritz_ patrickas: that's curious :-)
pmichaud rokoteko: (perl 5 for dummies) -- I can see how that could be inferred from the post. It's not that Perl 6 is dumber -- it's just cleaner.
pmurias McFist: you can still do my $foo = @_[0] if you want
huf McFist: what would be the advantge of making the default harder to reason about with no gain at all?
rokoteko pmichaud: I was just curious about your point and you gave a relatively good explanation. but as it was perlmonks, maybe you could've added all this yadadada there also. :)
McFist pmurias: yeah, but it's not cool )
pmichaud rokoteko: I still can :-)
patrickas moritz_ yea ... in all cases what's the right way to take the last n items of an array ? 16:28
TimToady_ in this case, Perl 6 has chosen cleanliness and speed over a minor convenience
pmichaud The gain that McFist is after (I think) is that he doesn't have to write 'is copy' in order to modify a local copy of a parameter.
McFist huf: compatibility with c-infected brains, mine included :)
moritz_ patrickas: I don't know
jnthn I'm looking at this discussion and thinking, if we make the default something else, what do we gain? We make the code a bit less obvious for the programmer, we make it harder to analyze and understand a sub-routine in isolation (loss for the programmer and the compiler) and we move further away from functional programming ideals too.
huf McFist: perl isnt c, end of discussion :)))
McFist pmichaud: yes, thanks, also true 16:29
huf pmichaud: oh, right ;)
moritz_ patrickas: I think *-3..*-1 is supposed to work, but I can see why it doesn't work in the current spec
tylercurtis McFist: suppose you start working with an existing codebase, and you see a function like "sub foo ($a) { a; bunch; of; stuff; so; that; you; can; no; longer; see; the; signature; $a++; do-something-with($a); }" And you see the $a++ bit.
moritz_ and another reason why it doesn't work in rakudo
tylercurtis What does it do?
jnthn Yes, you might end up writing your code a bit differently due to the default being readonly.
I'm not convinced that'll make for worse code though.
TimToady_ I wonder if * + * could default the second arg to the first
pmurias tylercurtis: but you would have to look up to the signature regardless of the default 16:30
McFist tylercurtis: hmm I think I'd expect that $a is on stack and doesnt modify the caller -- isn't it natural?
moritz_ TimToady_: that would make my starry obfu work again. Great idea :-)
jnthn After all, the parameter name is the name for the thingy you expect to be passed as an argument.
rokoteko pmichaud: okie. just wanted to make this clear for me as I atleast somehow managed to interpret that post wrong. thanks for your time and all the effort you are doing for perl (6). :)
moritz_ McFist: forget the stack when you're talking about Perl 6
McFist moritz_: why?
moritz_ McFist: because there is no stack.
jnthn If you manipulate it in some way, you probably have a different thing and should probably stick it in a container with a more appropriate name.
pmichaud rokoteko: you're welcome 16:31
rokoteko: and thanks for your question; I'll see if I can clarify my comments more in the future (and the post as well if I think of how to do it)
moritz_ McFist: Rakudo is based on CPS (because parrot is based on it). There are signatures and parcels for passing arguments. No stack.
jnthn s/parcels/captures/ 16:32
moritz_ erm, right
rokoteko pmichaud: I dont mind. I can always ask here. and maybe Im the only one who feels this way. :) I feel Im not the majority. ;)
McFist moritz_: how does the recursion work then?
moritz_ McFist: just like any other function call, really
PerlJam TimToady_: if you did that, would that also affect N-ary whatevers like * + * + * + * ? 16:33
masak I'm against * + * being of variable arity, because it would create hard-to-track-down odd behaviours in closures. Do Not Want.
moritz_ McFist: see de.wikipedia.org/wiki/Continuation-passing_style
McFist moritz_: thanks, I know what cps is
jnthn masak: I'm inclined to think it's a tad too clever too...
moritz_ McFist: then what's the problem with recusion?
pmurias moritz_: isn't what you describe a form of a stack
McFist and I don't know german anyway )
TimToady_ it's not an argument stack
McFist aha 16:34
TimToady_ it's a context stack
pmichaud rokoteko: (not majority) sure, but I can still try to tune my delivery a bit. at any rate, thanks again for your question, it's very helpful.
TimToady_ to be sure, a callframe is likely to have a pointer to its arguments
moritz_ pmurias: no, it's more of a general graph
McFist hm well anyway, stack or not, I'd expect $a++ modifies only the memory visible to the current function run, not the caller 16:35
tylercurtis McFist: even if you specifically ask for modifying the caller?
moritz_ McFist: then be glad that in Perl 6, it doesn't modify what the caller sees
McFist tylercurtis: no, of course
I'd consider "is rw" a dangerous thing, as it is in perl5
but we're talking about defaults 16:36
moritz_ rakudo: sub f($x) { $x++ }; my $a = 5; try { f($a) }; say $a
p6eval rakudo 90637b: OUTPUT«5␤»
moritz_ look, it didn't modify $a
isn't that great?
pmurias moritz_: isn't the default readonly?
moritz_ pmurias: yes
TiMBuS implement 'is cow', everyone wins (except pmichaud who has to implement it)
:3 16:37
McFist moritz_: wait, how could $x++ work if it is readonly? I'm confused
pmurias McFist: how often do you modify the argument?
PerlJam TimToady_: if "is cow" isn't specced, that should probably happen first :)
moritz_ McFist: it threw and exception
McFist aah
PerlJam McFist: note the try block
McFist yes
"is cow"++ 16:38
TimToady_ cows are overrated
PerlJam TiMBuS: er ... see what I just erroneously said to TimToady_
moritz_ Mu!
TiMBuS heh i saw
McFist (default "is cow") even more ++
PerlJam TimToady_: at least they don't have GILs
moritz_ -> afk
McFist pmurias: not often, but when I do it given the unpleasant feeling if it's readonly 16:39
gives
jdv79 the signatures/captures aren't really going to be used for compiler optimizations are they? just saw jnthn's EU talk.
jnthn jdv79: Huh? Of course they're useful information for the compiler. 16:40
jdv79 you gave an example of using they to transform trees - constant folding...
jnthn jdv79: We might be able to statically work out which candidate a multi-dispatch shoudl go to at compile time and save going thorugh the multi-dispatcher, for example.
TimToady_ there's another more fundamental reason for readonly, which is that Perl 6 is trying to bias programming more in the direction of side-effect-free FP
jdv79 *them
jnthn jdv79: Oh
jdv79: Sorry, mis-grokked what you meant. :-) 16:41
McFist TimToady_: that's a much better argument that a vague and totalitarian "we want to control $x = 42" :)
than
jnthn jdv79: I've no idea if we'd actually write it that way. You do want to match stuff in trees though at some level.
jdv79: I mean, PAST is really the tree form that the compiler users.
jdv79: So the example was realistic in that sense.
(where the compiler = Rakudo)
TimToady_ well, language designers have to think on many levels at once, and you were asking on a more detailed level, so it took a while to generalize in my head 16:42
McFist I might even like that level, at least
TimToady_ most of these design decisions are made for many reasons, not all of which are easy to articulate
16:42 cozmic left
PerlJam I think this is the first time I've seen anyone imply that TimToady_ is totalitarian. 16:42
It's like I'm in the twilight zone or something :) 16:43
jdv79 i found it surprising but interesting
McFist oh please don't paint me che guevara, alright? :)
sorry if that offended anyone though 16:44
TimToady_ certainly not me
jnthn jdv79: I guess it depends how efficient we could make it. 16:45
masak PerlJam: I've seen it on Reddit as well. it was absurd there as well.
PerlJam McFist: Any other language design issues you'd like to discuss? :-)
TimToady_ I already know I'm vague and totalitarian :)
TiMBuS TimToady_, is making a copy not free of side effects?? just curious
McFist PerlJam: i'm leaving already, thanks for the hospitality
jnthn jdv79: fwiw, PAST nodes are already represented as Captures.
jdv79: So it may not be such a bad fit.
PerlJam TiMBuS: sure, but at the expense of always copying. Would you rather it be side-effect free and only those who need copying pay the cost? 16:47
(and only pay it where they need it)
16:47 cozmic joined
TiMBuS PerlJam, of course, but that goes back to the overhead issue more than side effects. anyway i was just legitimately curious about whether copying cured side effects or not 16:49
PerlJam TiMBuS: aye. 16:50
masak ostatic.com/blog/is-perl-6-imminent...ybody-care
"Just when many were set to write Perl off, it may surprise people once again." 16:51
TimToady_ in pure FP, nothing is mutable, so it doesn't matter if you copy or not
PerlJam masak: a funny (to me at least) quote from there is "Wall himself seemed to imply that a finished version might be available by Christmas." :-)
pmichaud masak: iirc, Tim O'Reilly said a similar thing at his OSCON keynote a few years ago :) :)
masak PerlJam: :D 16:52
pmichaud: it's becoming truer by each year!
pmichaud I'm still waiting for another blog post where someone writes "nobody cares about Perl 6" so that I can reply "I care." :-)
jnthn masak: Love the comments... "C# and Java nerds are running scared. Perl 6 will destroy themb."
masak RAWR
jnthn masak: But I'm a Perl 6 *and* C# nerd. Do I destory myself? ;-)
PerlJam pmichaud: Tim O'Reilly said that TimToady could "see around corners". I'm still wondering how he can do that :) 16:53
masak jnthn: no, it's more of a 50% destroys 50% situation :P
pmichaud jnthn: Yes. By definition if you care about both you've already destroyed yourself. :)
masak PerlJam: using LTM, probably.
jnthn :P
pmichaud PerlJam: it has to do with immortality.
masak great. I try to go home, and suddenly it's Silly Hour. 16:54
pmichaud PerlJam: immortality also implies the ability to send things back from the future, I think.
PerlJam nothing is new under the sun?
tylercurtis jnthn: Wait until you finish the new metamodel, at least. :P
masak in FP, everything is immortal.
PerlJam: nowadays, it's "nothing new under the oracle".
rokoteko moritz_: sorry I didn't answer you as pmichaud happened to respond to me and I got caught up with that. But I dunno about the Abigail situation, but that is seriously an Extreme case. There's no reason to compare anyone mortal (like me) to Abigail. :) Anyhow. I think Abigail might also get interested (if not yet) what you are doing, when perl6 shows its power. ie. do what you used to did with perl5, just as easily, and we offer all this more.
pmichaud PerlJam: and right now, everything under the Sun is likely to get you sued for patent infringement :-P 16:55
masak rokoteko: tl;dr :)
16:56 squeeky joined
squeeky rahhh. 16:56
masak squeeky! \o/
McFist well anyway people if you consider "is cow" that'd be really great 16:57
McFist afk
rokoteko personally Im bit confused about what is different between my $bar = &foo; and my $bar := &foo; .. to me it would be easier if there was only one only one syntax for everything but many different ways of using the syntax. :)
masak: tl;dr ?
squeeky masak: I'm not back for good reasons.
the Configure.pl issues sprung up again. le sigh.
masak :/
jnthn tylercurtis: Is it more terrifying that I chose to write to prototype in C#? :-) 16:58
.oO( Maybe the metamodel will destory me. o_O )
masak rokoteko: on reddit-like sites, that's an expression meaning "too long, didn't read". I meant to imply that your line of IRC was, er, longish. :)
squeeky Wow, tl;dr is about 7 years old now. First showed up on SomethingAwful. 16:59
rokoteko masak: ahh. it was a long while ago that I was supposed to response. :)
masak nom &
16:59 masak left
tylercurtis jnthn: as long as it ends up back on Parrot, $_ !~~ :terrifying. 17:00
jnthn tylercurtis: Oh yes, it will. :-) 17:01
17:01 envi^home left
pmichaud rokoteko: a more accurate statement of my comment would be something like "I don't need to target Perl 5 programmers, because they already know Perl is beautiful. They'll start migrating to Perl 6 when it's ready for them, and even if they don't ever migrate, that's great -- they're still following the Perl philosophy. The bigger impact is on all those yet-to-be-programmers who someday will be looking for a programming language to use, and Perl 6 can h 17:02
tylercurtis is tempted to attempt to write a Parrot runtime for it in Winxed or something now that he has more free time.
:)
TimToady_
.oO(Perl 6 can h)?
 17:03
pmichaud can hopefully attract them."
(must've gotten cut off)
17:04 kuzuha joined
pmichaud lunchtime here, then $otherjob 17:04
then I think I'll do some more profiling for a bit 17:05
any word on the release eta?
17:05 kuzuha_ left
jnthn pmichaud: I think mathw++ said he'd cut the tarball this evening. 17:06
pmichaud: As in, UK evening.
It'd only be 6:13pm there ATM so not quite evening yet :-)
pmichaud okay, wfm.
gfldex Somebody will have to save all those PHP dudes. Perl 6 is gonna do that. :)
pmichaud I'll bbl
17:09 bla123 joined 17:10 justatheory joined
rokoteko pmichaud: well that was a *bit* better. but to add to this again; why the extensive use of "I" ? I thought the butterfly logo was the spokesbug for perl6? 17:11
17:11 dakkar left
pmichaud rokoteko: oh, because I'm only talking about my motivations for Perl 6. I don't speak for the language (yet?) 17:12
Perhaps I do speak for the language and don't realize it yet :)
rokoteko pmichaud: :)
PerlJam pmichaud: you speak quite well for the language at conferences from what I've seen :) 17:13
moritz_ rakudo: class A { }; say pir::typeof__SP(A) 17:14
p6eval rakudo 90637b: OUTPUT«A␤»
rokoteko hmm.. so is there any difference between my $foo := &bar; ..vs.. my $foo = &bar; ? 17:18
gfldex it's a different operator 17:19
so if somebody did magic with either operator, it will be different for sure :)
rokoteko nothing else?
moritz_ rokoteko: yes, binding makes $foo read-only
tylercurtis star: my &foo = -> $x { say $x }; my $bar = &foo; &foo = -> $x { say -$x; }; $bar(5) 17:20
p6eval star 2010.07: OUTPUT«5␤» 17:21
tylercurtis star: my &foo = -> $x { say $x }; my $bar := &foo; &foo = -> $x { say -$x; }; $bar(5)
p6eval star 2010.07: OUTPUT«-5␤»
rokoteko ok. I kinda understand the point. I wonder mainly wondering why .WHICH for both returned the same.
17:21 ash_ joined
rokoteko but to get to the point, why I wondered about this... 17:21
patrickas rakudo: say (1,2, *+*+* ... 20)
p6eval rakudo 90637b: OUTPUT«12»
rokoteko rakudo: sub foo (Int $x) { 1 .. $x }; push my @arr, &foo.assuming($_) for 2..5; say join ", ", @arr[2].() 17:22
p6eval rakudo 90637b: OUTPUT«1, 2, 3, 4␤»
rokoteko how would you do this using the read-onlyness of := ?
jnthn With my $foo = &bar; you have a scalar container which now holds a code object.
With my $foo := &bar; the $foo symbol directly references the code object. 17:23
And you don't have the container.
iiuc.
17:23 Italian_Plumber joined
moritz_ jnthn: could you please take a look at nopaste.snit.ch/22909 ? 17:25
17:25 bla123 left
moritz_ I tested it with 17:25
./perl6 -e 'class A { }; grammar B is A is Array { method TOP { "foo" } }; say A ~~ Grammar'
and it's false
and the debugging output says that both parent classes are 'Class'
rokoteko jnthn: ok. but shouldnt $foo.WHICH be different for the former and latter? or what Im missing here?
moritz_ that's what the typeof returns
rokoteko: .WHICH on a scalar acts on the object, not the container 17:26
rokoteko moritz_: ahh. how can I make it act on the container? 17:27
jnthn moritz_: YOu just discovered what happens when you don't have type objects...
rokoteko rakudo: my &bar = { 1 }; my &foo1 = &bar; my &foo2 := &bar; say &bar.WHICH ~ "/" ~ &foo1.WHICH ~ "/" ~ &foo2.WHICH
p6eval rakudo 90637b: OUTPUT«124312272/124312272/124312272␤»
jnthn rokoteko: VAR($a).WHICH I guess 17:28
17:28 thebird left
rokoteko moritz_: the above example doesn't act on scalar... what's happening there? 17:28
pmurias tylercurtis: what's winxed?
17:29 justatheory left
moritz_ rokoteko: .WHICH acts on the object; the object is &bar every time. 17:29
ash_ pmurias: winxed is a language based off javascript for parrot, see code.google.com/p/winxed/ its by NotFound++
rokoteko rakudo: my &bar = { 1 }; my $foo1 = &bar; my $foo2 := &bar; say &bar.WHICH ~ "/" ~ VAR($foo1).WHICH ~ "/" ~ VAR($foo2).WHICH
p6eval rakudo 90637b: OUTPUT«Could not find sub &VAR␤ in main program body at line 22:/tmp/gyUzUEPAfD␤»
rokoteko NYI? 17:30
moritz_ seems like
jnthn: is there an easy(-ish) fix?
rokoteko ok. Then it's obviously the wrong time trying to figure this out. :)
jnthn moritz_: Ah, yes 17:31
moritz_: (sorry, took me a moment to realize the easy way :-)) 17:32
moritz_: Get the Parrot class object associated with Grammar
And then use eq_addr
17:32 buzzlightyear joined
jnthn To see if they're the same thing. 17:32
moritz_: Let me know if you need more details on how to do that. 17:33
moritz_ jnthn: ah, but I want to also consider the parent's parent
jnthn Oh...hm
oh
moritz_ jnthn: so I'd end up re-implementing isa, no?
jnthn moritz_: No, you can get Parrot to tell you the MRO I guess 17:34
inspect with "all_parents" to get that
Then you just have to look through that.
moritz_ I'll try that, thanks
jnthn moritz_: You're might be getting and inkling of why I'm re-doing the meta-model stuff. :-)
17:34 risou_ left
moritz_ :-) 17:35
jnthn yowser I has a hungry 17:38
jnthn takes a nombreak
17:41 buzzlightyear left
pmichaud www.perlmonks.org/?node_id=856089 # not news, but maybe interesting to others 17:51
afk, lunch 17:52
17:53 Trashlord left 17:55 pyrimidine left, pyrimidine joined 17:56 Trashlord joined 17:57 cotto_work left, pyrimidine_ joined, Holy_Cow left 17:58 Holy_Cow joined 17:59 pmurias left, pyrimidine left, pyrimidine_ is now known as pyrimidine 18:01 daxim left 18:04 cotto_work joined
Exodist Hmm. C pisses me off, I think I will switch to implementing Oyster-Perl6 on Go. 18:04
(good excuse to learn Go as well)
18:06 pyrimidine is now known as py[tab] 18:09 araujo left, araujo joined 18:11 tadzik joined 18:15 mberends joined, patrickas left 18:16 Mowah joined 18:20 djburiedalive joined 18:21 djburiedalive left
sorear good * #perl6 18:24
18:24 stephenlb joined 18:25 stephenlb left 18:26 stephenlb joined
tadzik good evening 18:26
sorear niecza: use Test; ok True, "can load modules from p6eval"
p6eval niecza 4770bf5: OUTPUT«(timeout)»
sorear niecza: use Test; ok True, "can load modules from p6eval" 18:27
p6eval niecza 4770bf5: OUTPUT«ok 1 - can load modules from p6eval␤»
sorear needs to make niecza faster :/
moritz_ jnthn: hm, doesn't work with all_parents either 18:28
18:28 Mowah left 18:29 alester left 18:30 alester joined
sorear moritz_: just add Grammar to the end of the list, C3 will DTRT 18:31
(unconditionally)
moritz_ wow. Then I don't understand C3 correctly 18:32
sorear also, why shouldn't grammar Foo is Any work
class Foo is Mu works
moritz_ because class != grammar 18:33
18:38 eternale1e is now known as eternaleye 18:43 mantovani left 18:44 mantovani joined 18:46 blogometer_ joined 18:47 blogometer left, blogometer_ is now known as blogometer, Trashlord left
colomon pmichaud, TimToady_: does the strict laziness requirement for .lines imply that basically every normal filter method must also be strictly lazy? For instance, .grep. 18:49
My backscroll here doesn't go far enough, but someone suggested something like $IO.lines.take-until('------')
could that then simply be $IO.lines.grep('--------').shift ? 18:50
18:50 Trashlord joined
moritz_ (fwiw, irclog.perlgeek.de/perl6/today has nearly infinite backscroll :-) 18:51
colomon moritz_: yeah, but I have nearly infinite laziness.
ash_ colomon: dont worry, thats a virtue i hear in these parts 18:52
PerlJam wonders if anyone has specced .first 18:53
sorear .[0] is shorter
[Coke] you mean .car?
sorear and it's .head anyway
18:54 blogometer left
colomon .head versus .car religious war! 18:54
phenny Can't connect to versus .car religious
ash_ isn't just [0] shorter than .[0]? 18:55
moritz_ .head sudokugarden.de/
phenny moritz_: 200, text/html, utf-8
colomon PerlJam: yup, .first is in there and does exactly what I want in this case.
but I think .grep makes the point clearer. 18:56
ash_ rakudo: my @a = 1..3; say @a.first; # NYI ?
p6eval rakudo 90637b: OUTPUT«No candidates found to invoke for method 'first' on object of type 'Array'; available candidates have signatures:␤:(Mu : Mu $test;; *%_)␤␤ in main program body at line 22:/tmp/1cnSc6QSEi␤»
ash_ rakudo: my @a = 1..3; say @a.first 1;
18:56 pmurias joined
p6eval rakudo 90637b: OUTPUT«===SORRY!===␤Confused at line 22, near "say @a.fir"␤» 18:56
pmurias ruoso: ping
colomon rakudo: my @a = 1..3; say @a.first(* %% 2)
p6eval rakudo 90637b: OUTPUT«2␤»
ash_ ah 18:57
rakudo: my @a = 1..6; say @a.first(* %% 2), ' ', @a.grep(* %% 2).shift;
p6eval rakudo 90637b: OUTPUT«2 2␤»
pmurias Exodist: what is Oyster-Perl6?
sorear pmurias: hi 18:58
pmurias sorear: hi
sorear pmurias: why do you use require "viv"
pmurias don't remember 18:59
i can try to stop using that and check if anything breaks
sorear plans to move viv out of @INC at some point, at which point that will pick up an old version
pmurias viv defines some VAST::* classes 19:00
PerlJam rakudo: my @a = 'a'..'z'; say @a.rotate(13);
p6eval rakudo 90637b: OUTPUT«nopqrstuvwxyzabcdefghijklm␤»
19:00 masak joined
pmurias sorear: Actions autogenerates missing ones 19:01
19:01 Italian_Plumber left
Exodist pmichaud, github.com/exodist/Oyster 19:01
masak moritz_: 'nearly infinite' is a bit of an exaggeration... :)
Exodist: oh hai.
pmurias sorear: but all of them inherit from VAST::Base
pmichaud assumes that was meant for pmurias.
Exodist oops, sorry pmichaud, that was for pmurias
damn tab completion in xchat 19:02
masak Exodist: happens to everyone in here :)
Exodist: we're both implementing self-hosting Perl 6 implementations. perhaps you saw my email.
Exodist I did, didn't I respond?
masak checks
nope. :) 19:03
Exodist oh, oops
moritz_ masak: well, it goes back a million line... that's quite close to infinity, for a backscroll
masak Exodist: forgot to push, like pmichaud? :P
Exodist masak, what lang is yours in?
masak Exodist: Perl 6.
hence the 'self-hosting'.
pmichaud assumes that "self-hosting Perl6" means "written in Perl 6" :-P
masak Exodist: I've yet to see much Perl 6 in your self-hosting impl. :P
diakopter P-:
Exodist lol, I mean your bootstrapping stuff. 19:04
masak Exodist: oh, that.
Exodist is it gonna be rakudo-strapped?
moritz_ akshually it's 1.9mio lines in #perl6
masak it *is* Rakudo-strapped.
doesn't compile/run itself yet.
doesn't by quite a bit, akshually.
pmurias Exodist: re Perl6-Go, perlito has a Go backend 19:05
diakopter whistles "These Rakudos are made for walkin'"
19:05 jaldhar left
masak diakopter: if Nike makes a shoe named "Rakudo", we're either hosed, or golden. 19:05
Exodist pmurias, ah, I was thinking of switching cause C is so stressful.
Go has a lot of things already just done for me. 19:06
masak Exodist: from what I've seen of your commits, your project has more of a bottom-up approach, and Yapsi has more of a top-down approach.
Exodist masak, yeah, trouth is I am most interested in implementing tha grammar engine. 19:07
cause it seems fun
masak Exodist: aye, that's why in my email I linked you to my Perl 6 implementation of a Perl 6 grammar engine.
it *was* quite fun to write. 19:08
so far I've given three talks about it. :)
19:08 rokoteko left
moritz_ talk-driven design! 19:09
masak moritz_: most of the development took place before the talks, though. :) 19:10
jnthn was there at The First Talk
masak between the first and the second talks I finally figgered out how to do backtracking right.
backtracking is clearly the fun part.
jnthn Actually, I think I've seen all three...
moritz_ rakudo: use fatal; open('nonexistant') 19:12
p6eval rakudo 90637b: OUTPUT«Operation not permitted in safe mode␤ in 'Safe::forbidden' at line 2:/tmp/UWF_orMPCL␤ in main program body at line 22:/tmp/UWF_orMPCL␤»
moritz_ works locally
pmurias sorear: dropping use viv seems to be mostly adding some VAST classes to viv 19:13
moritz_ oh, it's always fatal
masak jnthn: you might be the only one who has been to all three :)
moritz_ thinks masak also has been to all three 19:14
masak is not so sure himself
Exodist: anyway, I guess my point is this: if you ever want to discuss the finer points of bootstrapping a Perl 6 implementations, feel free to ping me :) 19:15
TimToady_
.oO(it's not really a "Perl 6 grammar" unless it does transitive LTM...mutter...mutter...grumble)
jnthn masak: I saw you at all of them. :P 19:16
Exodist masak, thanks will do.
masak jnthn: might've been one of my clones. :P
PerlJam wonders if soon it will be some sort of rite of passage to implement Perl 6
moritz_ TimToady_: just because you're the language desiger doesn't mean people listen to you :-)
jnthn o_O
masak TimToady_: I still haven't entirely ruled out trying to go against pmichaud++'s recommendation and refactor GGE into an LTM-y engine.
jdv79 transitive LTM sounds a bit painful 19:17
Exodist TimToady_, My goal is for mine to completely meet the spec, I just have to decide to stay in C or switch it to go.
moritz_ just need to construct a DFA, or something similar
"just"
masak Exodist: what a coincidence, that's the goal for my implementation as well! o.O
Exodist wait, whats the diff between ltm and transative ltm? 19:18
19:18 meppl joined
masak Exodist: ok, so do you know about ltm? 19:18
Exodist masak, yes
pugssvn r32059 | moritz++ | [t/spec] tests for RT #71362, $0, $1 etc. work even for $/ := $something
masak Exodist: transitive LTM is LTM that doesn't care whether different alternatives are $N levels down in a subrule, as long as they're alternatives in the same alternation. 19:19
Exodist: rule foo { <bar> | <baz> }; rule bar { a | b | c }; rule baz { d | e }; rule foo has 5 alternatives.
(that example showcases "transitive", but not "LTM") 19:20
sorear niecza: "fooo" ~~ / foo { say "A" } | fo* { say "B" } / 19:21
p6eval niecza 4770bf5: OUTPUT«B␤»
Exodist ok, Then what I have been thinking hits that case just fine where it takes longest to depth of alternates.
masak aye.
and it works correctly with backtracking :)
sorear Exodist: incidentally, I am also working on a p6 implementation that focuses on the grammar engine 19:22
Exodist sorear, I am following it on github
though I have not looked at it to depth.
pugssvn r32060 | moritz++ | [t/spec] test for RT #66694, redefining methods by augmenting stuff 19:23
masak "If I didn't believe that, I wouldn't have spent the last decade pouring my heart and soul into it." -- www.perlmonks.org/?node_id=855886 by TimToady_ -- wow, for some reason it was refreshing to read that sentence on PerlMonks. TimToady_++
moritz_ rakudo: say 0e999999999999999 19:24
p6eval rakudo 90637b: OUTPUT«NaN␤»
moritz_ "huh"
masak actually, that whole post is rather warm an fuzzy.
s/an/and/
sorear It's more accurate than GHC's result
colomon rakudo: say 0e99999999 19:25
moritz_ sorear: what does GHC return?
p6eval rakudo 90637b: OUTPUT«NaN␤»
colomon rakudo: say 0e99
p6eval rakudo 90637b: OUTPUT«0␤»
moritz_ oh. It takes longer. Much longer.
colomon rakudo: say 0e999
sorear moritz_: nothing; the parser starts by evaluating 10^999999999999999 as a bignum
p6eval rakudo 90637b: OUTPUT«NaN␤»
colomon yeah, that's it all right. rakudo is evaluating 10^999 before multiplying it by zero.
moritz_ rakudo: say 0e999999999999999 == 0 19:26
colomon rakudo: say 10 ** 999
p6eval rakudo 90637b: OUTPUT«0␤»
rakudo 90637b: OUTPUT«Inf␤»
colomon rakudo: say Inf * 0
p6eval rakudo 90637b: OUTPUT«NaN␤»
pugssvn r32061 | moritz++ | [t/spec] test for RT #70600, 0e9999999 19:27
sorear hacks his copy of STD to increase the error limit from 10 to 10k 19:29
[Coke] TimToady++
sorear [Coke]: What did he do this time? 19:30
[Coke] is merely catching up in backscroll.
... is there anything in here that monitors karma?
masak sorear: because you really like errors? 19:31
sorear buubot: karma TimToady
buubot sorear: TimToady has karma of 312
sorear buubot: karma lwall
buubot sorear: lwall has karma of 801
masak buubot: karma karma
buubot masak: karma has karma of 4
masak buubot: karma 4
buubot masak: 4 has karma of -329
masak o.O
buubot: karma -329
buubot masak: -329 has karma of
tadzik :D
masak buubot: karma 19:32
buubot masak: has karma of
masak ok, we've reached Zen.
tadzik :D
jnthn buubot: karma dogma
buubot jnthn: dogma has karma of 1
masak dogma++
masak puts some karma in his dogma
jnthn EKARMARANOVERDOGMA
[Coke] <monty python>There is noooooooooooooooooooooooo Perl six</>
masak [Coke]: was that why you asked whether anything monitors karma? :) 19:33
[Coke] masak: ha! no. just wondering if karming people mattered except warmandfuzzily
masak I get the feeling that keeping count is mostly incidental to the warm and fuzzy part. 19:35
but I might be wrong.
[particle] puts some llama in his karma 19:36
TimToady_ karming is more important than karma
mathw Right
I've done aikido, I've had fish and chips, I've drunk a ridiculous amount of water and I'm ready to go
masak cheers mathw on
[particle] well then, what are you doing here? /kick mathw 19:37
[Coke] no programmers were karmed in the release of this software.
tadzik they must be sad now
masak sad llama in snow
TimToady_ First of all, do no karm. --Hoppo Crates
tadzik sad llama is sad
TimToady_ *Hippo
masak quickly patents the new llama meme 19:38
tadzik I thought Hoppo is a pun
TimToady_ Hippo Hoppo Crates is someone else
masak I thought his name was Groucho Crates.
[particle] Harpo Crates
masak Happy Happy Hippo Crates.
tadzik Crapo Haters
masak no wait, that's Hungry Hungry Hippo Crates.
mathw Is anybody aware of any problems with the release? 19:39
colomon mathw++
tadzik is anyone aware of the release? :)
TimToady_ is anyone aware at all?
mathw tadzik: the release hasn't happened yet, I'm about to do it
But now is the time to yell 'stop!!!'
but only if there's a reason
masak mathw: I saw an odd failure in S03-operators/context.rakudo earlier today when spectesting.
tadzik stop!... oh, ok
mathw masak: did you fix it? 19:40
masak mathw: of course not.
I promptly forgot about it and moved on with my life.
I'm only remembering it now.
mathw pfft
useless
TimToady_ not having released it seems to be the largest problem :)
masak does the sad llama routine
mathw TimToady_: Well I had to go to aikido, because if the release isn't right I'm going to have to defend myself :)
pmichaud the context.t failure should be fixed after my delayed push of this morning
19:41 TimToady_ is now known as TimToady
sorear masak: Quite the opposite, the more I see at once the faster I can get rid of them 19:41
[particle] is your git constipated?
pmichaud mathw: if something goes wrong with the release, you're in good company :-)
mathw pmichaud: :)
pmichaud runs a "make spectest" just to check 19:42
mathw I'm almost kicking off a spectest run here
just waiting for it to build...
masak fwiw, context.rakudo passes outside of the harness.
mathw awesome
masak so probably nothing to worry about.
19:42 py[tab] left
pmichaud (transitive ltm) -- fwiw, nqp-rx does manage to do transitive ltm in some cases :) 19:42
it just doesn't manage it in all of them yet. 19:43
mathw does "make spectest"
masak if it doesn't do all of them, it's Not A Real Perl 6 Grammar Engine.
pmichaud I don't know that any implementation is truly a Real Perl 6 Grammar Engine yet :-)
mathw Isn't that why it's called Not Quite Perl?
masak that is correct.
no wonder people complain about Perl 6 not being finished yet. 19:44
mathw lol
pmichaud heh
mathw oh so we should've called it Bucket then?
masak because it's... round?
pmichaud so, while yapsi claims "complete and official", nqp explicitly claims "not quite" and "not official"
mathw Everybody say 'boo' for pmichaud's naming
1/22 failed in S02-literals/numeric.t 19:45
masak pmichaud: "not quite not official"
pmichaud yes, I get a numeric.t failure also 19:46
19:46 x3nU left
pmichaud that feels new 19:46
mathw good thing it's not just me
19:46 azert0x left
pmichaud investigates. 19:46
mathw watches for other ones
pmichaud I think it's a new test that was added that needs fudging.
mathw this is the problem with me doing the release, I have to get other people to fix things :)
pmichaud aha 19:47
#?todo 'RT 70600'
fudge fail
colomon yup, needs fudge
mathw OOI, what's the correct way to fudge
pmichaud should be #?rakudo todo 'RT 70600' 19:48
pugssvn r32062 | pmichaud++ | [t/spec]: Fix fudge in S02-literals/numeric.t
mathw aaah
pmichaud to distinguish it from all of the other Perl 6 implementations, where it works already :-) 19:49
mathw I knew fudging was implementation-specific, honest
PerlJam mathw: the correct way to fudge is to get other people to do it :)
mathw rofl 19:50
is 'get pmichaud to do it' the answer to everything tonight? :)
pmichaud fwiw, "release manager" and "delegation" go well together
i.e., the release manager doesn't have to do all of the work; just needs to make sure the release goes out (correctly)
mathw :)
I can do that
been doing a bit of this sort of thing at work lately too
but people keep changing the spec underneath me there :( 19:51
pmichaud ...releases?
mathw: I know the feeling well.
(changing spec :-)
mathw yeah, a bit of coordinating everything into a point where we can release it to the QA team or to internal customers or something
which is great, it's like "hey, why did you put this in what doesn't work? Fix it!" 19:52
mathw likes svn blame
not seen any more failures yet 19:53
forgot how big the spectest is
probably a lot bigger than it was last time I did one though
19:55 shade_ joined, prz joined
mathw S05-modifier/ignorecase.rakudo dubious, test returned 1 19:58
tadzik running various Perl 6 snippets of mine shows that today's Rakudo is from 2 to 20 times faster than 2010.06
pmichaud \o/
mathw well the ChangeLog mentions integer performance improvements
that is very awesome
pmichaud I knew those delay loops I snuck into the 2010.06 release would prove helpful. :-P 19:59
tadzik almost everything's 2 times faster, 20 times faster is the code adding integers in a loop :P
which is colomon++ and pmichaud++
19:59 x3nU joined
colomon final improvement is mostly pmichaud++'s. 19:59
oh, and he is particularly responsible for the fact that they're not just integer improvements, any Range iteration should be faster now. 20:00
mathw eeww 20:02
I smell :(
straight in the bath after the release is done I think!
20:03 Tene joined
PerlJam mathw: sounds like you have good timing. aikido, release, bath. sounds cathartic. 20:04
mathw yeah
aikido, bath is good enough
a rakudo release as well is almost unbearable
:)
pmichaud only spectest failure I had was numeric.t, which is now working. 20:05
mathw good
moritz_ yeah, I messed up the fudging
mathw I'm in S32 tests at the moment
so we're looking good if nothing goes wrong here? 20:06
moritz_ sorry about that
mathw I love how many trig tests there are
tadzik hmm. Is it possible that a module was working well a month ago and it is not passing tests now?
mathw yes
20:06 azert0x joined
moritz_ tadzik: yes 20:07
ash_ i blame colomon++ for all the trig work, i am sure there are others i am missing though
mathw things do change
tadzik I'm talking about Config::INI, it stopped parsing stuff. Is that expected/normal?
mathw modules are quite susceptible to breaking iwth changes in Rakudo
moritz_ tadzik: have you removed all stray .pir files?
pmichaud depends on whether it was relying on any bugs that are now fixed :-)
tadzik moritz_: will check once again
moritz_ at least that's the most common reason for my modules to fail 20:08
mathw yup
same here
tadzik nah, this is something else
and I remember it failing when I WAS SMOKE TESTING PERL6 MODULES :) 20:09
(in case you didn't know/remember yet :))
maybe it's time for a new test though 20:10
before Star
20:11 rjbs joined
rjbs There's a question that's been nagging me for months, and I finally am going to just ask! 20:11
20:12 sjohnson joined
[particle] (false laziness)-- 20:12
rjbs The confusion of {hash} and {sub} is such a huge pain in Perl 5. I know that it's slightly less of a pain in Perl 6, but I wonder why it wasn't solved more thoroughly.
mathw right
[particle] {} always means closure in perl 6
mathw everybody happy with the release being cut now? 20:13
tadzik yes!
masak mathw: \o/
moritz_ but sometimes it's run immediatly
mathw: +1
pmichaud [particle]: my $x = {};
mathw right then
moritz_ rjbs: I guess it has to do with not having enough bracing characters
rjbs This first started to bug me when I read the Perl 6 cheat sheet, which shows %hash{'a'}
masak pmichaud: I think what [particle] meant was what the spec says: that {} always means closure.
jnthn rakudo: my $x = {}; say $x.WHAT;
p6eval rakudo 90637b: OUTPUT«Hash()␤»
masak pmichaud: some of them might evaporate into hashes, though. 20:14
pmichaud well, the spec is misleading then. :-)
masak not really.
pmichaud or at least quoting that part of the spec is misleading :)
masak a hash is just a "special case" of a closure :)
x3nU moritz_: using some strange unicode characters as bracklets would be a "good" idea ;d
masak not a subclass, but a special case.
rjbs moritz_: I thought about that, but there seem to be some bracing characters that could have been put to use for hash/closure as opposed to (say) qw.
16:14 <masak> a hash is just a "special case" of a closure :)
pmichaud my $x = {}.();
rjbs ^ Intuition Fail!
mathw testing the tarball
rjbs mathw: Good luck!
pmichaud rakudo: my $x = {}.();
p6eval rakudo 90637b: OUTPUT«invoke() not implemented in class ''␤ in main program body at line 22:/tmp/5AP2C7WAiF␤» 20:15
pmichaud {} is always a closure.... except when it's not. :-)
rjbs Right, and that has been such a source of irritation in Perl 5! Is it just a "well, we want to stay Perlish"?
masak rjbs: you may or may not have read use.perl.org/~masak/journal/40431 , where I talk a bit about this.
rjbs Quite possible! 20:16
pmichaud rjbs: I think it's a desire to retain the notion of "anonymous hash"
masak rjbs: sumamry of that post: the fact that {} was used for both used to bother me in Perl 6, but nowadays I find the rules simple enough to follow, and it bothers me very little.
rjbs You know, I think I did read that, and I felt unsatisfied. :)
masak good to know :)
sorear I for one would not be opposed to a :{} for hashes, {} for closures thing
mathw it would be nice if there was another set of brackets on the keyboard for that
but it doesn't really bother me at all for some reason 20:17
moritz_ rjbs: I agree the that it's still confusing; however one thing has drastically improved, and that is that you never get a syntax error from soemthing that starts to be parsed as a hash, and then turns out to be a closure
rjbs pmichaud: Right -- but I wondered why that wasn't (say) < ... >
I do agree that it's a huge improvement.
pmichaud well, < ... > has a more useful meaning, I think.
I wonder if %{ ... } would work for an anonymous hash :-) 20:18
PerlJam not using {} for hash constructionwould have just pushed things too far away from their perl-nature ;)
moritz_ there's also hash { ... }
just like sub { ... }
sorear pmichaud: +1
pmichaud one could get away with %( ... ) for building an anonymous hash, but then it's not itemized
hash { ... } fails, I think.
at least it fails if you're expecting { ... } to be a closure 20:19
masak right, it's 'hash ...'.
moritz_ huh?
ash_ rakudo: my $a = {; }; say $a.WHAT;
p6eval rakudo 90637b: OUTPUT«Block()␤»
pmichaud moritz_: 'hash' is just a listop 20:20
pugssvn r32063 | moritz++ | [t/spec] RT #75768, indexing a series with a series. Makes colomon++ unspeakably happy
pmichaud it doesn't impose any special interpretation on curlied arguments
rjbs If I want a closure that returns a pair, I need to say something like: {; 1 => 2 } ? 20:21
(or add a return, or whatever)
sorear Yes
ingy greetings from boston
colomon \o/
mathw oh hai ingy
ash_ rakudo: say ({; a => 2 })().WHAT;
mathw you're just in time for the release
p6eval rakudo 90637b: OUTPUT«===SORRY!===␤Unable to parse postcircumfix:sym<( )>, couldn't find final ')' at line 22␤»
pmichaud rakudo: say { 1=>2; }.WHAT
p6eval rakudo 90637b: OUTPUT«Hash()␤»
ingy oh yeah?
pmichaud hmmmm 20:22
ingy * release or what?
pmichaud I suspect that ought to be a closure.
sorear +1 in favor of %(), btw
pmichaud sorear: what about the flattening behavior?
rjbs See! Aren't you glad I came to whine :)
masak we're always glad when people come to whine.
that means they care.
moritz_ rjbs: yes; it's always good to ask questions
pmichaud people are whining and dining us all the time :-)
ash_ rakudo: say ({; 1=>2; }).WHAT, ' ', ({ 1=>2; }).WHAT 20:23
p6eval rakudo 90637b: OUTPUT«Block() Hash()␤»
moritz_ well, there's productive whining, and annoying whining
mathw THE TARBALL IS UP!
sorear pmichaud: the only case I've seen where flattening of hashes is an issue is in Array.push, which IMO should be changed to take a (non flattening) parcel now that you can say push: |@list
pmichaud sorear: my @a = { 1 => 2 }; my @b = %( 1 => 2); 20:24
masak mathw++
sorear Why are you assigning hashes to arrays in the first place?
20:24 djburiedalive joined
masak moritz_: just as there's productive dining, and annoying dining :P 20:24
pmichaud I might want an array to contain a hashref
the first gives @a[0] a hash. The second gives @a[0] a Pair. 20:25
mathw I think I sent it from the right email address, so hopefully the announcement won't bounce off perl6-compiler
20:25 djburiedalive left
pugssvn r32064 | moritz++ | [t/spec] test for RT #74530, hyper ops and ranges should mix 20:25
ash_ rakudo: ({; a => 1 })().WHAT.say # is a block that returns a pair
p6eval rakudo 90637b: OUTPUT«Pair()␤»
moritz_ any volunteers for next month's release?
mathw++ can tell you how easy it is :-) 20:26
pmichaud rjbs: fwiw, you can always explicitly signify a block with ->
mathw hee
that wasn't too bad
pmichaud rakudo: say (-> { a => 1 }).WHAT
p6eval rakudo 90637b: OUTPUT«Block()␤»
rjbs pmichaud: {; works just as well, doesn't it?
pmichaud rjbs: sure.
mathw just kind of nervous
rjbs It's what I use in P5 and is shorter! :)
mathw glad the procedure's all sorted out
ash_ pointy blocks let you have arguments though
pmichaud well, non-pointies allow that too :-) 20:27
ash_ rakudo: my $a = -> Int $foo { say 'int'; }; $a(1); $a('foo'); # but not type checking
p6eval rakudo 90637b: OUTPUT«int␤Nominal type check failed for parameter '$foo'; expected Int but got Str instead␤ in <anon> at line 2:/tmp/ZxUDeUZ__i␤ in main program body at line 22:/tmp/ZxUDeUZ__i␤»
ash_ well, you could do your type checking in the block i guess 20:28
but thats no fun
pmichaud right, that would be +Ofun I guess.
ash_ is there a way for making an anonymous multi?
moritz_ rakudo: use Test
p6eval rakudo 90637b: ( no output )
masak rakudo: { die "AAARH!" unless $^a ~~ Str; say $^a }.($_) for "OH LOL", 42 20:29
moritz_ ash_: how would you add candidates?
p6eval rakudo 90637b: OUTPUT«OH LOL␤AAARH!␤ in <anon> at line 22:/tmp/jdqlXX4ya4␤ in main program body at line 22:/tmp/jdqlXX4ya4␤»
ash_ like, anon multi sub Int $a { }, sub Str $a { };
moritz_: *scratches head* beats me
jnthn No, though folks ask now and then
masak anonymous multies? that's crazy talk.
mathw oh by the way
moritz_ with cheating, you can do do { multi a() { ... }; multi a($x) { .. }; &a } 20:30
jnthn But since they're lexical, you could easily make a sub that constructs and returns anon multis.
mathw oh ignore me, I just answered my own question
jnthn Or that.
:-)
moritz_ or
mathw I'm goin gto have some cider instead
masak maybe create an anon proto, and add variants to it through some method on the routine?
colomon cider++
moritz_ my $x = anon multi foo() { }; $x.push(anon multi foo($x) { ... })
or was it .candidates.push? not sure
but we have a method API 20:31
mathw: I've received your p6c mail, so no problem here
jnthn Cider. It's like apple beer.
mathw moritz_: awesome
all done then
moritz_ -> bed
ash_ multi sub (Int $a) { ... } and sub (Str $a) { ... };
jnthn moritz_: Something like that. But if we give people a way to modify the candidate list dynamically, they'll get a surprised when discovering that the optimizer did stuff 'cus it didn't know about their added candidates. 20:32
20:32 javs left
jnthn Or put another way, we probably only want to allow it with a pragma. 20:32
tylercurtis jnthn: perhaps a trait?
ash_ my $foo = multi sub (Int $a) { ... } and sub (Str $a) { ... }; $foo(1); $foo('a');
jnthn tylercurtis: Well, pragma would be anal. to MONKEY_TYPING 20:33
masak jnthn: please don't abbreviate 'analogous' that way. :/
ash_ std: my $foo = multi sub (Int $a) { ~$a } and sub (Str $a) { +$a }; $foo(1); $foo('a');
p6eval std 32064: OUTPUT«ok 00:01 121m␤»
mathw yes
please
jnthn masak: I couldn't remember if it was an "o" or an "a" after the l :P 20:34
I concede a spelling mistake woulda been better... :-)
masak jnthn: either one is better.
jnthn: mnemonic: analog clocks
jnthn :P 20:35
tylercurtis jnthn: yes, but I think you're more likely to just want to pessimize one multi than all multis in a scope.
ash_ multi sub (Int $a) { ~$a } and sub (Str $a) { +$a } and sub ($a) { 'others' };
jnthn tylercurtis: Yeah, true.
OTOH, you often only want to monkey with a couple of types too... 20:36
ash_: Did you steal that from ML? :-)
masak ash_: not sure infix:<and> should be mis-used in that way... outside of a pragma.
ash_ no, i don't know ml
jnthn ash_: ah, it uses something like it for
grr
ash_ masak: i know, i was just looking for an infix:<op> that made sense and passed std :P
jnthn *for mutually recursive functions
masak ash_: infix:<|> feels less wrong to me than infix:<and>. 20:37
still wouldn't want that functionalirt in core Perl 6, though.
tylercurtis With MONKEY_TYPING, you still have to specify when a class declaration is supposed to be monkeying around with augment or supersede.
jnthn True
pmichaud my $foo = Multi.new( sub (Int $a) { ... }, sub (Str $b) { ... })
masak ash_: you can already do infix:<|> on routine signatures.
jnthn oh
That's not bad 20:38
Then we could declare tha Multi is immutable once created.
masak pmichaud++
ash_ don't take my suggestion to seriously, i was more toying with std
jnthn And be happy
masak std: multi sub foo (Str $a, Int $b) | (Int $a, Str $b) { ... }
pmichaud or that one can create new multis from existing ones
p6eval std 32064: OUTPUT«Potential difficulties:␤ $b is declared but not used at /tmp/wBnnRpbog0 line 1:␤------> multi sub foo (Str $a, Int ⏏$b) | (Int $a, Str $b) { ... }␤ $a is declared but not used at /tmp/wBnnRpbog0 line 1:␤------> multi sub foo (Str ⏏$a, Int $b) |
..(…
masak hrm.
std: multi sub foo (Str $a, Int $b) | (Int $a, Str $b) { say $a, $b; }
pmichaud i.e., Multi.new could know what to do with other Multis as arguments
p6eval std 32064: OUTPUT«ok 00:01 122m␤»
ash_ std: multi sub (Str $a, Int $b) | (Int $a, Str $b) { say $a, $b; } 20:39
p6eval std 32064: OUTPUT«ok 00:01 121m␤»
ash_ thats kinda weird though, since there is only one { } block
std: multi sub foo (Str $a, Int $b) { say $a, $b; } | (Int $a, Str $b) { say $a, $b; }
p6eval std 32064: OUTPUT«===SORRY!===␤Two terms in a row at /tmp/_k2EOa2puT line 1:␤------> Str $a, Int $b) { say $a, $b; } | (Int ⏏$a, Str $b) { say $a, $b; }␤ expecting any of:␤ bracketed infix␤ infix or meta-infix␤ statement modifier loop␤Parse
..failed␤FAILED 00:0…
ash_ i think Multi.new is the current logical solution, :P 20:40
masak +1 20:41
jnthn +2
ash_ anyway, back to hacking on the try.rakudo.org backend
jnthn \o/
masak ash_++
tadzik ash_++
ash_ its a lot hard to manage multiple processes with a single daemon than i originally thought... 20:42
tadzik ash_: did you thought about keeping a pipe to a REPL instead of writing to a file and executing it? 20:43
mathw process management is horrible
pmichaud gist.github.com/538865 # jnthn, any ideas about how to make this (abridged) codepath faster? 20:44
ash_ tadzik: ya, thats the only way to do it properly, i have a POE server that spawns sub processes now, each new connection to the server makes a new subprocess that lasts as long as the session, once the session dies the sub process is killed
its about 80% done, then i need to test it
tadzik awesome!
pmichaud essentially, that's the code generated for token ws { <?MARKED('ws')> } 20:45
jnthn pmichaud: Looking.
pmichaud (I took it from the original "token ws" rule and cut out the parts that aren't on the <?MARKED...> codepath 20:46
and of course, by 'faster' I mean 'significantly faster'
sorear What does <? do? 20:47
pmichaud zero-width positive assertion
invokes the subrule, and passes if the subrule passes
sorear oh, right, d'oh
pmichaud (but doesn't consume any characters)
and actually, the code that normally gets executed is only down to the 'debug_401:' label 20:49
i.e., we never reach anything after the first .return (rx70_cur)
jnthn pmichaud: Remind me what the four things taht cursor_start returns are?
pmichaud a new cursor 20:50
the current position
the target string
I forget what $I10 is -- probably "are we scanning or anchored" or something like that
jnthn unused here anyway I guess
pmichaud right
I might be able to move/postpone the target string setup that takes place at substr rx70_tgt, rx70_tgt, rx70_off 20:52
but I can't see that having a significant impact on execution time.
oh yes, $I10 is whether we're invoking the rule for the first time or whether we're backtracking into the rule (which we never do in this case)
masak mathw++ # release announcement on p6c!
pmichaud mathw++ # excellent -- nice and quick!
20:53 perlygatekeeper1 joined
mathw I still haven't got it :( 20:53
jnthn pmichaud: What came of the proposal to have the string equal at... op?
mathw but now it's time for my bath
jnthn That'd avoid a string header...
mathw goodnight all
thanks for the support and assistance
PerlJam mathw++ 20:54
jnthn mathw++ # thanks for doing the release
pmichaud jnthn: I tried it in a branch, and it resulted in a <0.1% improvement
jnthn Wow.
mathw oh and looking at my schedule... I can do next month as well
pmichaud it's possible I got that part wrong.
jnthn That...surprises me a little.
But OK.
pmichaud it surprised me a lot
here's what I'm looking at for this particular case
jnthn pmichaud: I mean, every run through we're doing ~ 3 method calls.
pmichaud when I run the parser on NQP/Actions.pm
I get timings that look like 20:55
sorear I'd be very suspicious of that small a result
20:55 perlygatekeeper left
sorear Wait 20:55
Was substr_eq_at provided in _s_sc_i or only _s_s_i?
jnthn I figure that !cursor_start, !cursor_pass, !cursor_pos and MARKED don't go making other pricey calls?
pmichaud jnthn: I've tried to make them as efficient as I could, yes.
jnthn sorear: It'd generate the SC version unless they went to effort to make it not do so
pmichaud sorear: I'm suspicious also.
it was _s_sc_i 20:56
anyway
I get
ws : 6700 1.4943 6700 1.4943 0 0.0000
jnthn pmichaud: Yeah. I mean, without making all the primitives here cheaper, or inlining, it's hard to see what to do.
pmichaud which tells me that 6700 calls to ws took 1.4943 seconds
jnthn Ouch
That feels...more than it should be.
pmichaud that includes the cost of debugging and tracing
jnthn ah, OK
pmichaud but relatively speaking, that should be constant
jnthn What % overhead did we get from debugging/tracing, ooc? 20:57
pmichaud more to the point, those 6700 calls to ws took more time than anything else
jnthn More than any other rule?
pmichaud yes.... but now I see the problem.
jnthn Because of the call volume?
pmichaud the debugging/tracing is likely swamping the noise
right, because of the call volume
jnthn Or even when you factor it out?
OK
pmichaud I don't know how to factor it out.
jnthn Well, I mean
If you divide the number of calls into the time we spend in ws 20:58
tadzik will there be anyting on p6u and rakudo.org?
jnthn Is it a relatively expensive rule
dalek ecza: b284300 | sorear++ | / (2 files):
Add an option to generate self-contained executables
jnthn Or is it just pure volume?
pmichaud I'm guessing here it may be just pure volume
jnthn OK
20:58 ash_ left, wamba left
jnthn I mean, we know that method lookup and attribute lookup are going to get cheaper. 20:59
pmichaud if I do the division, I get 0.000222 second per call
jnthn But that's probably not until October.
pmichaud (that's including tracing overhead)
jnthn gets curious how MARKED works
pmichaud it just looks up values in a hash and returns true/false
[particle] wonders what the tracing overhead is
pmichaud but more to the point, I can look at the trace output itself and determine that 0.000076 seconds for this code path is in ws itself, and not in Marked 21:00
21:00 prz left, ash_ joined
pmichaud or, put another way, by looking at the trace output, I can see that this code path takes 0.000109 seconds 21:00
jnthn Ah, OK
MARKED unconditionally calls debug, fwiw
(!cursor_debug)
Rather than checking if it should. 21:01
pmichaud ah, you're correct.
21:01 whiteknight joined
pmichaud anyway, that's unchanged in this thought experiment :-) 21:01
21:01 perlygatekeeper1 left
pmichaud anyway, this code path takes 0.000109 seconds 21:01
this is the *optimal* code path -- i.e., we call the <.ws> rule and immediately discover that we're at the end of a <ws> sequence and don't need to check further 21:02
21:02 Guest23195 left
jnthn pmichaud: Also in MARKED and MARKER you might save some runloop overhead using the vivify op 21:02
or fetch
Whichever one it was
For the global %!MARKED
er 21:03
%!MARKHASH
pmichaud: Could that become an attribute in the future?
pmichaud sure, or a dynlex
more likely a dynlex, it's per-compilation-unit.
jnthn attributes we're going to be able to lookup by index, I expect
pmichaud STD has it as a dynamic var.
jnthn dynlexes are EWW for performance 'cus you have to go chasing down the lexpads for 'em.
pmichaud so we're a little constrained.
jnthn That doesn't make it a good idea. 21:04
pmichaud I might be able to optimize it into an attribute, yes.
jnthn Is the rest of ws maybe the more expensive bit?
pmichaud no, I can time the execution of *this* codepath.
jnthn $P1 = self.'pos'() # where's this defined, oc? 21:05
*ooc
pmichaud 'pos' is a method on the cursor object.
you're straying from my question, though.
jnthn pmichaud: aye, I'm just trying to grok the bigger picture here 21:06
21:07 justatheory joined
pmichaud what I'm seeing is that exclusive of the calls to MARKER, this codepath requires 0.000072 seconds per execution 21:08
jnthn rakudo: say 0.000072 / 0.000109
p6eval rakudo 90637b: OUTPUT«0.660550458715596␤»
pmichaud more to the point: 21:09
jnthn So we spend 66% of our time in the stuff other than int he call to MARKED?
pmichaud rakudo: 0.000072 * 6700
p6eval rakudo 90637b: ( no output )
pmichaud rakudo: say 0.000072 * 6700
p6eval rakudo 90637b: OUTPUT«0.4824␤»
pmichaud that's debug-inclusive time, of course, but more to the point, the overall (debug) time needed to process the file was 10.5 seconds 21:10
so fully 0.5 seconds (5%) of the time was spent in this codepath
(I'm rounding a bit there) 21:11
rakudo: say 0.4824 / 10.6
p6eval rakudo 90637b: OUTPUT«0.0455094339622642␤»
pmichaud 4.5%
in this codepath, *exclusive* of the call to MARKED
the calls to MARKED added another 0.24 seconds on top of this 21:12
21:12 ash_ left
pmichaud 20:59 * [particle] wonders what the tracing overhead is 21:12
jnthn pmichaud: substr rx70_tgt, rx70_tgt, rx70_off # we don't seem to use this in the code MARKED code path?
pmichaud jnthn: right -- as I said, I could potentially delay that
i.e., to do that only when we're about to do an operation that requires inspecting the target 21:13
(i.e., when we don't follow this codebath)
*codepath
I'm just thinking that can't be a significant part of the overhead.
jnthn I can't imagine asking for a string's length is expensive either, though.
pmichaud yes, that should be almost instantaneous, since we keep the length around 21:14
jnthn Right.
And the rest is just integer comparrisions and branches, which should also be almost instantaneous.
Well, and assings and so on, but still, all just integer arithmetic
*assigns
pmichaud okay
I think that answers my questions a bit (more) 21:15
21:15 ruoso left
pmichaud I'll go back and double-check the remaining methods that we call to see if they're slowing things down 21:15
but unless there's something there that's unnecessarily slow, it looks like the bulk of the time is method call overhead, and the only real option for improving this is to avoid method calls as much as possible (even if it violates encapsulation) 21:16
...or wait for method call times to improve :) 21:17
here's an example trace:
1282248378.766728 19/0 START ws 21:18
1282248378.766764 19/0 START MARKED name=ws
1282248378.766801 19/0 PASS MARKED
1282248378.766837 19/0 PASS ws at pos=19
jnthn pmichaud: Thing is, every time we do !cursor_start, we do $P0 = lang.'HOW'() which in turn goes and does a hash lookup
sorear has a 389K Hello.exe which runs in 1.56 seconds, does anyone care?
pmichaud sorear: sounds about as fast as rakudo! :-)
jnthn pmichaud: That's going to end up being a dynop that does a pointer follow and an index and is done. 21:19
pmichaud jnthn: ultimately, that's probably going to end up having to be self.'new'() though
jnthn pmichaud: That's just one place where we're paying for P6object layering on Parrot's object model today rather than being "natively" implemented.
pmichaud or something .'new'()
sorear pmichaud: but rakudo doesn't have a --gen-app Hello.exe option. :)
jnthn pmichaud: Ultimately you won't want it written in PIR.
pmichaud: Because hard-coded integer v-table offsets will be a nightmare headache. ;-) 21:20
[particle] all it does is say "hello, world!", but you can change the grammar at runtime.
:)
pmichaud jnthn: well, sure. My point is that Cursor creation is going to need to go through the standard build sequence.
jdv79 i thought the reason to use parrot's implementation was to make it more inter-language friendly, no?
jnthn pmichaud: Oh, I totally agree.
pmichaud if that's faster, then \o/
jnthn pmichaud: The point is I think that sequence can be fast.
pmichaud I very much look forward to it :)
jnthn Anyway, I think we're drowning in overhead there rather than doing anything inherently inefficeint. 21:21
Having a JIT to churn through those integer ops would be wonderful too of course.
But I suspect the real overhead is in dispatch-y stuff. 21:22
pmichaud any suggestions how I could improve the lang.'HOW'() create-an-object part?
i.e., would it be a Win to avoid that call altogether somehow?
jnthn Don't think we have a way without breaking encapsulation of P6object right now.
Well, wait
pmichaud I don't mind if we break P6object encapsulation, if it's a big enough Win. 21:23
jnthn $P0 = lang.'HOW'()
parrotclass = getattribute $P0, 'parrotclass'
cur = new parrotclass
Oh...grr...no
hnag on, let me check something
masak hey, it never struck me before: DESTROYALL submethods will usually be called with little or no memory left. 21:24
pmichaud .sub 'HOW' :method :nsentry $P0 = typeof self $P1 = getprop 'metaclass', $P0 .return ($P1)
masak (from a discussion on #parrot)
pmichaud .end
looks like .'HOW' is fairly efficient already.
jnthn pmichaud: It is, it's just the overhead of having to do a method call. 21:25
pmichaud: And a hash lookup
pmichaud maybe worth inlining here, since !cursor_start gets called An Awful Lot?
jnthn pmichaud: Rahter than having it a pointer or so away
pmichaud: Well, it'd save a method call and thus a Context PMC for every time we call !cursor_start
pmichaud okay. 21:26
I'll look into that also.
jnthn pmichaud: Though this will end up as a dynop "get_how" or some such.
pmichaud At the moment I'm surprised at how much method call overhead seems to dominate parsing.
[particle] jnthn, pmichaud: is there a timeline on when a new parrot mop might be done? one of the cardinal folks is wondering, since the object model is where they're hung up
pmichaud I would've expected the parsing itself to be more costly.
jnthn Just about all the calls we ever make are on the invocant though?
pmichaud I don't understand the question. 21:27
[particle] they can't subclass parrot;Class
pmichaud [particle]: oct/nov, I think.
jnthn [particle]: Aiming for Oct.
pmichaud jnthn: if you're asking if most of the calls are on self, then no.
jnthn pmichaud: Oh? 21:28
pmichaud most of them are on the cursor object returned by !cursor_start
jnthn pmichaud: How much can we statically know about the type of that?
pmichaud very little.
jnthn oh damm. :-(
That sucks.
pmichaud in general we can probably assume that it's the same type as self, though.
jnthn Yeah, but it's knowing when we can't... 21:29
treed also, jnthn I am here too
er, [particle]
pmichaud cursor_start expects to return the same type of cursor as the invocant
and only does otherwise if :lang is specified
and since we know that :lang isn't being specified here, we could assume 'self'
[particle] oh, look at that :)
jnthn Aha
treed (and highlighted on "cardinal") 21:30
jnthn pmichaud: OK. The short story is, the more we know about the type of the thing we're calling on, the more likely we can dispatch it by v-table lookup.
pmichaud jnthn: got it.
jnthn pmichaud: That is, the model I'm designing actually takes gradual typing seriously.
tadzik treed: you are the Ruby on Parrot guy?
treed More or less.
jnthn pmichaud: And deeply.
pmichaud: Same for representation polymorphism.
treed I haven't done much lately, due to being blocked on the object model.
Tene tadzik: He's the last guy to work on it. Before him, it was me.
treed There are some others who've worked on it too. 21:31
tadzik I see. Anything new in it? It didn't work last time I took a look
jnthn treed: I'm very hopeful that what I'm working on will give you the flexibility to implement the model you need. 21:32
treed: In a sense, if it doesn't, I've got it wrong.
treed Heh.
jnthn *I'll have got it...
21:32 patrickas joined
treed If you want to chat sometime about how the Ruby object model works, let me know. 21:32
pmichaud jnthn: thanks for the review -- it helps a ton.
jnthn Yes, that would be helpful.
pmichaud: Really? I didn't feel so helpful. :-)
pmichaud: Or at least, didn't have a good "this is how" answer. :-)
pmichaud I was more looking for confirmation that I wasn't overlooking an obvious expensive step. 21:33
21:33 drbean joined
jnthn pmichaud: cursor_start does a lot of shuffling stuff around that is just more pricey than it really should be ATM. 21:33
pmichaud: It's not that it's badly written so far as I can tell. 21:34
pmichaud well, it's just binding attributes for the most part.
jnthn pmichaud: Just the primitives it's built on.
Right
sorear treed: I however would love to hear about more object models.
jnthn treed: Yes, that'd be good to know.
Tene treed: I'm also interested in being around for that conversation. 21:35
tylercurtis also.
Tene It's storytime with treed!
jnthn :-)
pmichaud grabs milk and cookies.
jnthn grabs beer...what's new... ;-)
treed Heh.
So every ruby object is an instance of an anonymous class, called its eigenclass. 21:36
masak grabs an object. have something concrete to refer to during the story.
treed Which is derived from what you thought you said to derive the object from.
masak treed: one unique eigenclass per object?
by the way, are we allowed to interrupt? :) 21:37
treed just a sec
(work calls)
And, yeah, one unique eigenclass per object. 21:38
IIRC eigen- means self-
sorear So, "hello world"
That's a string object? 21:39
masak ja, eigen- means self-
sorear And it has an eigenclass, which is not shared with any other string in the system?
treed I think so, although I suspect that eigenclasses may not actually be created until used.
sorear knows essentially nothing about Ruby-the-language
treed You can add methods to any given object. 21:40
ANd when you do, they're added to the eigenclass.
It would surprise me if the eigenclass actually existed until that point.
sorear so it's essentially a prototype OO system?
treed (I was going to implement it like that. Creating it on the fly as needed.)
Kinda, yeah.
So each class also has a metaclass, which is where class methods and data go. 21:41
jnthn treed: www.klankboomklang.com/2007/09/21/t...ton-class/ suggests that it's done lazily
masak so, eigenclass != metaclass in Ruby?
sorear Can you give an example of a simple user-defined class?
treed class Foo
def bar
puts 'hi'
end
masak: Nope. 21:42
masak they're the same?
treed ruby-doc.org/ruby-1.9/classes/Class.html
Er.
masak rakudo: class Foo { method bar { say 'hi' } }; Foo.new.bar
treed that was an agreeing nope.
p6eval rakudo 90637b: OUTPUT«hi␤»
masak aha.
treed That has a diagram of classes and metaclasses at the basic level
so each class has a metaclass and a superclass.
And metaclasses have superclasses of their own.
Ultimately leading to BasicObject. 21:43
(Which is new in 1.9)
tylercurtis Do metaclasses also have metaclasses?
treed Nope.
jnthn Oh no, no strange loops. :-) 21:44
masak will be disappointed. :-)
treed Heh.
masak 'the buck stops here'.
Tene Aren't metaclasses instances of Class?
treed Yes.
Tene So they just all have the same metaclass (Class)
masak jnthn: I'm used to being disappointed in that way. most systems are depressingly non-loopy.
treed Ultimately.
Tene Yeah, from that document, "All metaclasses are instances of the class `Class’. " 21:45
treed So, then I guess they could have a metaclass.
In that way.
Agh.
Yeah.
So, now imagine this, only for each thing, I also have to have a parrot thing. 21:46
Tene I don't know that that's any more or less meta-
sorear treed: How many addressable objects does your class statement create?
treed And you understand why I got stuck on complication.
sorear: Hm.
Addressable?
sorear The class, the metaclass, the class' eigenclass, the metaclass' eigenclass, ...?
can be assigned to a variable
treed two, I think
You can't assign an eigenclass to a variable. 21:47
sorear more objects could be created behind the scenes
treed Sure.
The class is addressable, and the metaclass, via Class.class
masak the eigenclass isn't first-class? :)
treed Heh.
Most people never even realize that it exists. :-P
I've certainly never used it.
I didn't even know about it until I started working on Cardinal. 21:48
masak man, we should demote junctions before people start realizing that they exist... :)
sorear btw I'm planning to make junctions non-addressable in Niecza, at least to start
Tene sorear: eigenclasses aren't made until you try to define instance-specific behavior.
sorear in Rakudo, class Foo { } creates two addressable objects - Foo (aka Foo.WHAT) and Foo.HOW 21:49
Tene So just defining a class doesn't create any eigenclasses.
sorear also Foo.WHO, but that's not really part of the object system
jnthn Tene: That correlates nicely with what I'm reading.
treed Yeah, I think that's also the case with Ruby.
You get a class placed in a namespace
sorear (Foo.WHO is the name of the implicit namespace created to hold our variables inside the class body)
treed and the metaclass which is accessible via Class.class 21:50
jnthn treed: If you like, when I get further along, I could maybe take a crack at an implementation of the core of this.
treed I don't think it creates anything else until you use the eigenclass.
jnthn: That'd be neat.
Tene So how do you define class methods in ruby?
masak treed: non-related question. sometimes I read on Twitter that people think that Ruby is the actual Perl 6. what is your view on this?
treed I'm so burned out on getting it to work.
jnthn treed: It'd be an interesting model test.
treed class Foo
def Foo.class_method
21:50 whiteknight left
treed end 21:50
end
masak: Drugs?
masak treed: :D
jnthn treed: Yes, I can imagine this is hard to model with current Parrot.
masak treed++
treed I kinda view Ruby as a hybrid between Python and Perl. 21:51
tylercurtis Doesn't def self.class_method work also inside the class?
Tene jnthn: it wouldn't be so bad if you could instantiate subclasses of Class
jnthn treed: I very much hope to make things better.
treed But it's definitely more Pythonic than Perlish.
masak I'll answer that next time. "I'm sorry, but are you high?"
treed jnthn: The code exists on github in a branch if you want to see my current attempt.
It's... ugly.
jnthn Tene: Yes, classes ended up less first-class in Parrot that I'd kinda hoped.
treed tylercurtis: I think so, yeah.
Tene I was rather disappointed when I noticed that.
masak treed: the use of special vars is quite Perlish. but it isn't used much in modern Ruby, it seems. 21:52
jnthn treed: Depends if it does the right thing or will just confuse me. ;-)
treed Heh.
Tene Fixing the class restrictions on the exception workins was pretty easy, but I haven't merged that branch yet.
That branch merge has been pending for... five months?
treed github.com/cardinal/cardinal/blob/i...lasses.pir
I think that's the core of the nastiness.
jnthn treed: Are you using PCT for implementing this? 21:53
treed I ... think so?
masak (also from #parrot) seems one of the few places where 'reverse iterators' are used is in BUILDALL. maybe the only place. we should perhaps think of moving away from that solution, so that reverse iterators can be deprecated.
21:53 pmurias left
treed It's just the standard parrot set. 21:53
jnthn treed: Yes, you are
treed P6 rules for grammar, NQP for actions, and PIR for writing libs
Tene jnthn: I never got it migrated to nqp-rx
jnthn treed: Though not nqp-rx
treed Ah, yeah.
jnthn Tene: Right.
Tene: That may be helpful.
treed Was there ever a guide written for that.
jnthn Tene: I'll be putting the new MOP-y stuff in nqp-rx. 21:54
tylercurtis The Squaak tutorial's up-to-date now.
masak yay
treed By "that" I mean converting from nqp to nqp-rx.
sorear treed: Sounds like the Rakudo and Ruby metamodels are quite similar
treed sorear: I never really grokked the Rakudo model.
I ended up excising P6object because it didn't seem to do what I wanted.
And had weird bugs. 21:55
sorear treed: Rakudo doesn't have eigenclasses, but an object's class pointer is mutable
Tene sorear: Rakudo doesn't so much have class-only methods.
sorear So you can get the same effect by deriving an anonymous class and setting it as the object's class
Tene iiuc, you can't define a method that you can call on Foo, but not on instances of Foo
sorear Tene: type objects are the big difference, yes 21:56
masak Tene: there's :D and :U, though.
Tene: (only spec so far, not in Rakudo)
sorear :D and :U suck.
masak no, :U suck! (SCNR)
Tene :D and :U seemed... hackish, to me, I guess.
masak I also have mixed feelings about them.
sorear and very, very ugly
jnthn I found them quite nice. 21:57
Just an adverb to the type name.
masak I might change my mind after I've tried them in practice.
jnthn *find
masak: You shoudln't have to write them much...
masak no, :U shouldn't have to write them much! 21:58
jnthn Then :Don't complain! :D
masak :P
sorear Over in Moose-land, Str:D is spelled Str
jnthn No, we don't have that one.
sorear If you want Maybe[Str], you have to say so
much better huffman, IMO
masak likes Maybe[Str]
21:58 Holy_Cow left
masak unfortunately, I don't see how that'd mesh with type objects... 21:59
jnthn Heh. I don't think type objects are going away any time soon. :P
masak right. :U
21:59 _madmax_ joined
jnthn
.oO( :U is a really difficult facial expression to form )
 21:59
masak :∩ 22:00
sorear there's an interesting cheat in Moose, initial values are excempt from type constraints
it would make my Int $x = foo(); work, at least
jnthn masak: Oh noes, what have I set off... :P
masak :d 22:01
Tene :D 22:02
yay puns :D
D: oh no puns
jnthn Is that punctuation? 22:03
sorear Now for the part where I add if ($M->isa('STD::Regex')) checks to every single backslash__S_foo action method
masak groans
Tene emoticons. ":D" is happy, "D:" is upset.
sorear (:
sbp ‿̈ 22:05
treed Whoa it's sbp.
Small world. 22:06
sbp yup!
[particle] someone else highlighting "cardinal"?
sbp I crack Unicode jokes on #perl6
treed Huh?
sjohnson y0
sbp it's what I do
treed sbp isn't cardinal-related
masak sjohnson: hi! \o/
[particle] wrong world
sorear sbp? 22:07
sjohnson yo masak hows life
sorear treed: fwiw, I got to Perl 6 by following overlapping circles from #nethack 22:08
sbp sup sorear?
sorear sbp: me without context as to "Whoa it's sbp"
sbp treed has been on one of my channels for years and years
Tene too
masak sjohnson: life is being suspiciously kind and generous. how's with you?
sjohnson works a bit boring today, but seeing new things that p6 can do usually cheers me up 22:09
masak sjohnson: allow me to cheer you up, then :) 22:10
rakudo: say Nil.defined # amazing, isn't it? :)
p6eval rakudo 90637b: OUTPUT«0␤» 22:11
masak \o/
sjohnson yeah i remember i was playing around with defined back then
err, back a while ago. i gotta be careful with hashes
rakudo: my %hash; say defined(%hash)
p6eval rakudo 90637b: OUTPUT«1␤»
sjohnson rakudo: my @list; say defined(@list) 22:12
masak rakudo: say 42.?foo // "Ints don't have a .foo method, silly! :)"
p6eval rakudo 90637b: OUTPUT«1␤»
rakudo 90637b: OUTPUT«Ints don't have a .foo method, silly! :)␤»
masak sjohnson: there's discussion about @list being undefined also.
sjohnson interesting...
sjohnson pays attention
（　｀ー´）
sorear .u ー 22:13
phenny U+30FC KATAKANA-HIRAGANA PROLONGED SOUND MARK (ー)
22:15 stephenlb left
squeeky ( ﾟ ヮﾟ) 22:16
masak sjohnson: there's a long ticket about it on RT. when I last showed it to pmichaud, he said that arrays and hashes will probably end up being undefined before use. 22:17
sjohnson: I suspect that it was my bitching about it not being that way that led TimToady to spec :D and :U.
so maybe we can implement undefined Arrays and Hashes, close the ticket, unspec :D and :U, and live happily ever after :) 22:18
22:19 drbean left
jnthn masak: If you unspec those, you still leave other problems that they solve behind. 22:20
22:20 tadzik left
masak jnthn: Foo $x where *.defined 22:21
jnthn: Bar $x where !*.defined
jnthn masak: I'm thinking more than :D and :U may be meaningful in a specail sense to the mult-dispatcher.
masak: Remember ACCEPTS is one method we'd want to distinguish this way.
masak: And Str 22:22
masak right.
jnthn We don't want every call to those falling back to a subset dispatch.
22:22 stephenlb joined
jnthn :D and :U may well be different too. 22:22
That is, they may *really* mean "is a type object" and "is not a type object" rather than any higher level idea of what defined means.
(Very speculatory.) 22:23
So then it's not just ugly sugar for where *.defined :-)
masak if they really mean 'is a type object', I could see more use for them. 22:28
rakudo: say Int.WHICH; say Int.clone.WHICH; 22:29
p6eval rakudo 90637b: OUTPUT«91674640␤91674640␤»
jnthn masak: Would them meaning that feel objectional to you as a user?
(To me as an implementor, that feels very helpful.) 22:30
masak jnthn: it kinda feels right.
jnthn: it makes me feel better than them just meaning 'defined' and 'undefined'.
don't know why.
masak sleeps
'night, #perl6
jnthn night o/
22:30 masak left 22:34 patrickas left
sorear Tene: Why do you care about waltman? 22:38
22:38 blogometer joined
Tene sorear: I mostly don't. 22:39
I care at least a little bit about bring up less-false counterpoints to the uninformed anger.
cognominal A perl5 question. I want to convert a python extension to a Perl extensions. It seems that python has the equivalent of SV* but that any struct with starts with the fisrt fields of this SV equivalent can benefits from the garbage collecting while there only predefined SV derivative type. What is the way out? 22:49
s/with/which/
blogometer I'm using felixge Node MySQL. Does it have mute button? 22:50
A lot of debugging messages.
Oh, wrong window. 22:51
cognominal I thought that defining a new magic could work but it seems that all the magics are predefined : switches everywere?
blogometer Sorry.
sorear cognominal: you need to use 'ext' magic; in order to make sure you have your own magic, compare the vtable address 22:54
cognominal: also, the correct channel for hardcore Perl5VM hacking is #p5p on irc.perl.org
cognominal agreed but I knew that someone knowledgeable would help me here 22:55
thx 22:56
sorear see XS::Object::Magic on CPAN
23:01 _madmax_ left
cognominal sorear++ # that's sounds what I want. 23:02
23:08 blogometer is now known as _bigeasy, _bigeasy is now known as big_easy, big_easy is now known as bigsleazy
sorear Oh, great. I just noticed there are actually THREE sets of backslash: rules. 23:09
23:09 bigsleazy is now known as blogometer 23:10 patrickas joined 23:11 kensanata joined
sorear rakudo: say 1 ~~ /\w/ 23:11
p6eval rakudo 90637b: OUTPUT«1␤»
23:12 lestrrat is now known as lest_away
patrickas rakudo: (<a b>, { .succ } ... * ).[^3].map(.perl).say 23:14
p6eval rakudo 90637b: OUTPUT«No candidates found to invoke for method 'map' on object of type 'Parcel'; available candidates have signatures:␤:(Mu : &block;; *%_)␤:(Mu : %block;; *%_)␤␤ in main program body at line 22:/tmp/kGZNEzCpLT␤»
patrickas rakudo: (<a b>, { .succ } ... * ).[^3].join(', ').say
p6eval rakudo 90637b: OUTPUT«a, b, c␤»
patrickas should the fist element returned be 'a' or <a b> ? 23:15
sorear a 23:17
<a b> means "a", "b"
squeeky <cheap fast good> 23:18
23:18 jferrero joined
patrickas i know ... but does it flattem? 23:18
lue rakudo: say 1 «=« [1,2,3]
sorear yes
p6eval rakudo 90637b: OUTPUT«1␤Cannot modify readonly value␤ in '&infix:<=>' at line 1␤ in <anon> at line 204:CORE.setting␤ in 'hyper' at line 1␤ in 'hyper' at line 211:CORE.setting␤ in main program body at line 1␤»
sorear , always flattens
jnthn rakudo: say <cheap fast good>.pick(2)
p6eval rakudo 90637b: OUTPUT«cheapfast␤»
patrickas rakudo: (<a b> , 'c').perl.say 23:19
p6eval rakudo 90637b: OUTPUT«(("a", "b"), "c")␤»
patrickas rakudo: (<a b> , 'c').elems.say
p6eval rakudo 90637b: OUTPUT«3␤»
sorear .perl is kinda special
jnthn In the first, note it's never been promoted from a Parcel
sorear it ignores all flattening information in what it sees
jnthn Nothing enforced flattening context
.elems enforces it
Tene rakudo: (['a', 'b'], 'c').elems.say
p6eval rakudo 90637b: OUTPUT«2␤»
Tene rakudo: (['a', 'b'], 'c').perl.say 23:20
p6eval rakudo 90637b: OUTPUT«(["a", "b"], "c")␤»
lue rakudo: say 1 «==« [1,2,3]
p6eval rakudo 90637b: OUTPUT«100␤»
Tene See the difference?
lue rakudo: say (1 «==« [1,2,3]).perl
p6eval rakudo 90637b: OUTPUT«[Bool::True, Bool::False, Bool::False]␤»
23:20 hudnix joined
patrickas how can I explicitely promote form a parcel ? 23:20
in other words 23:22
somewheer in my code I am doing: my $args = @lhs.iterator.list
and it seems $args when I read from $args it "seems" I am getting <a b> as first element 23:23
jnthn patrickas: Anything that puts it in context would do that.
Oh, hmm
rgrau_ rakudo: ([<a b>], { .succ } ... * ).[^3].join(', ').say 23:24
p6eval rakudo 90637b: OUTPUT«a b, a c, a d␤»
jnthn rakudo: ('a', 'b', { .succ } ... * ).[^3].join(', ').say
p6eval rakudo 90637b: OUTPUT«a, b, c␤»
jnthn rakudo: (<a b>, { .succ } ... * ).[^3].join(', ').say
p6eval rakudo 90637b: OUTPUT«a, b, c␤»
patrickas the current series operator works fine 23:25
I am refactoring it
jnthn Ah, OK
patrickas and this is the only test not pasing in MY code
jnthn patrickas: How are you handling the LHS
?
.flat will put something in flattening context.
patrickas I'll try that 23:26
23:26 justatheory left
lue rakudo: my @a = (1 «==« [1,2,3]); say ( [+] @a ) 23:29
p6eval rakudo 90637b: OUTPUT«1␤»
lue rakudo: my @a = (1 «==« [1,2,1]); say ( [+] @a ) 23:30
p6eval rakudo 90637b: OUTPUT«2␤»
23:30 _madmax_ joined
lue am I the only one who can't run rakudo with the latest PARROT_REVISION ? 23:31
patrickas in all cases is it a bug ? 23:32
Tene my parrot_revision is 48547 the last time I rebuilt 23:33
patrickas I am handling @lhs like this
our multi sub infix:<...>(@lhs, Whatever) {my $args = @lhs.iterator.list; say $args.elems,@lhs.elems;} ; (<a b>, 'c' ... * );
Tene has it been updated since that?
patrickas rakudo: our multi sub infix:<...>(@lhs, Whatever) {my $args = @lhs.iterator.list; say $args.elems,@lhs.elems;} ; (<a b>, 'c' ... * );
p6eval rakudo 90637b: OUTPUT«23␤»
patrickas should that ^^ output 33 ?
lue parrot revision 48559 here
jnthn patrickas: If you're putting a list in a scalar then I guess you're itemizing it. 23:34
lue it's a parrot error concerning PackFile_unpack (wondering if it anyone else has this problem)
jnthn lue: That's normally a result of having left-over PBC files from an older Parrot. 23:35
sorear PackFile_unpack errors are never bugs
it just means you forgot to rebuild 23:36
lue I'm pretty sure I ran perl Configure.pl --gen parrot ; make ; make install like always
patrickas ok i'll work around by explicitly .flat-ing
lue [doing so again to make sure] 23:37
patrickas rebuild, spectest and hope for the best
what's funny is that the tests was for someting else (testing a block with arity 1) ... and it was the only one that caught my non flattenign bug! 23:39
23:39 bluescreen joined 23:40 bluescreen is now known as Guest82885
jnthn We need more tests. ;-) 23:40
lue
.oO(would standardized tests be easier for a Perl 6 implementation?)
 23:41
sorear lue: you forgot the git clean -dfx
lue just ran it. It's funny, I never had to do that before. 23:43
patrickas PASS \o/ 23:48
jnthn patrickas: \o/
23:48 jferrero left
sorear std: / \X[23,34,46] / 23:48
p6eval std 32064: OUTPUT«ok 00:01 116m␤»
sorear I wonder what that means., 23:49
squeeky TAP 2.0 needs to mandate the 4 stages of test: PASS \o/, FAIL /o/, UNKNOWN |o_ and NA /o 23:50
treed I don't get the UNKNOWN
Is that like raising hand to ask a question
squeeky treed: .... think YMCA. 23:51
Tene I don't get FAIL 23:52
squeeky think I'll just go and facepalm in my sleep.
patrickas night all 23:53
23:53 patrickas left
[Coke] perl Configure.pl --gen-parrot does NOT remove the old parrot build. this can cause trouble on some revision updates. 23:54

Powered by Cro and the Raku® Programming Language.

Please report any issues / comments / feature requests as an issue on App::Raku::Log.

Thank you!